pycom11g21840

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
OG0000158
Physical Location & Seq
Forward (+)
24854848 .. 24855708
861 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom11g21840.2

Sequence Viewer

Length: 687 bp
ATGCAACGGCCCCCAAACTTCTGCTGCAAGAAAATGACACCAGCAAACACTAAACCCCCAAAAGGAATTATGACATCACAAGCAGTGGATAAATTGGTGATGAGCAAAGTTGCGAGCCCTGTAAAGATCGTATGCATGTGGCAGCGCTCGAACAAAAGTTTTGCAGAACATGTTGAGCACAATTTGAGGCAGCAAAAAGCCGTCCAAAACCAAACCAGCATAAGATTTGAAGGTTCATGCAGAAGCAAAGCTGTGAAAGCCCCTGCAACGTATAGTAGTAAGGCCACAAAGAGTGTCTTTTTCTCCATGAGCCAGAGCTTGTTGCGATTTCCATTTTTTGATCGTGCTGACCAAGTTAGCTGCAGAAGACGGATTTGCAGCAAGAACGCTACCATTGTTATCACCCTCACAATTACCTCATTAACTTCAAGCCATCCTCCGGTTCCAAGGAACACATTTTGGCGGTTGGTGCTACTCATGAATATGGCTTCGAATAGCATGAAAATGGAAATGGAGGGAAGAACATCTGGATACTTTGTCACATGGAAGAGTTGTCGTGCCACAAAGAAGCACGCCAGCGTGGTGGATATAAGAACCAATATGATCTCCACATCCATCCTCCAAATGGACCGCCTTTCTTTGAAGAGGGTGAAGGAAGCTGAGGTTAAAACCCAAGTTTCAAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

229

Amino Acids

25.85

Weight (kDa)

10.54

Isoelectric Point (pI)

46.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 463, 631
AfeI AGCGCT 1 cut(s) 146
AfiI CCNNNNNNNGG 3 cut(s) 62, 439, 625
AflIII ACRYGT 1 cut(s) 169
AgsI TTSAA 4 cut(s) 230, 429, 643, 681
AluBI AGCT 4 cut(s) 251, 318, 360, 659
AluI AGCT 4 cut(s) 251, 318, 360, 659
Alw21I GWGCWC 1 cut(s) 180
Aor51HI AGCGCT 1 cut(s) 146
AoxI GGCC 2 cut(s) 8, 282
ApeKI GCWGC 5 cut(s) 24, 142, 190, 360, 378
AspLEI GCGC 1 cut(s) 147
AspS9I GGNCC 2 cut(s) 9, 628
AsuHPI GGTGA 3 cut(s) 109, 394, 661
AsuII TTCGAA 1 cut(s) 491
AvaII GGWCC 1 cut(s) 628
BanII GRGCYC 1 cut(s) 119
BbsI GAAGAC 1 cut(s) 373
Bbv12I GWGCWC 1 cut(s) 180
BbvCI CCTCAGC 1 cut(s) 660
BbvI GCAGC 5 cut(s) 11, 154, 202, 347, 390
BccI CCATC 2 cut(s) 441, 623
BceAI ACGGC 2 cut(s) 23, 185
BciVI GTATCC 1 cut(s) 524
BfmI CTRYAG 1 cut(s) 361
BfoI RGCGCY 1 cut(s) 148
BfuI GTATCC 1 cut(s) 524
BisI GCNGC 5 cut(s) 25, 143, 191, 361, 379
BlsI GCNGC 5 cut(s) 26, 144, 192, 362, 380
Bme18I GGWCC 1 cut(s) 628
BmgT120I GGNCC 2 cut(s) 9, 628
BmiI GGNNCC 2 cut(s) 11, 444
BpiI GAAGAC 1 cut(s) 373
Bpu10I CCTNAGC 1 cut(s) 660
Bpu14I TTCGAA 1 cut(s) 491
BsaJI CCNNGG 1 cut(s) 446
BsaWI WCCGGW 1 cut(s) 439
Bsc4I CCNNNNNNNGG 3 cut(s) 62, 439, 625
BseDI CCNNGG 1 cut(s) 446
BseGI GGATG 3 cut(s) 433, 611, 615
BseLI CCNNNNNNNGG 3 cut(s) 62, 439, 625
BseMII CTCAG 1 cut(s) 651
BseXI GCAGC 5 cut(s) 11, 154, 202, 347, 390
BshFI GGCC 2 cut(s) 10, 284
BsiHKAI GWGCWC 1 cut(s) 180
BsiSI CCGG 1 cut(s) 440
BslI CCNNNNNNNGG 3 cut(s) 62, 439, 625
BsnI GGCC 2 cut(s) 10, 284
Bsp119I TTCGAA 1 cut(s) 491
Bsp1286I GDGCHC 2 cut(s) 119, 180
Bsp143I GATC 3 cut(s) 126, 340, 603
BspACI CCGC 2 cut(s) 463, 631
BspANI GGCC 2 cut(s) 10, 284
BspCNI CTCAG 1 cut(s) 652
BspHI TCATGA 1 cut(s) 477
BspLI GGNNCC 2 cut(s) 11, 444
BspMAI CTGCAG 1 cut(s) 365
BspT104I TTCGAA 1 cut(s) 491
BssECI CCNNGG 1 cut(s) 446
BssMI GATC 3 cut(s) 126, 340, 603
BssT1I CCWWGG 1 cut(s) 446
Bst6I CTCTTC 2 cut(s) 542, 638
BstBI TTCGAA 1 cut(s) 491
BstC8I GCNNGC 3 cut(s) 115, 573, 577
BstDEI CTNAG 1 cut(s) 660
BstF5I GGATG 3 cut(s) 433, 611, 615
BstH2I RGCGCY 1 cut(s) 148
BstHHI GCGC 1 cut(s) 147
BstKTI GATC 3 cut(s) 129, 343, 606
BstMBI GATC 3 cut(s) 126, 340, 603
BstMWI GCNNNNNNNGC 2 cut(s) 257, 469
BstNSI RCATGY 2 cut(s) 139, 173
BstSFI CTRYAG 1 cut(s) 361
BstV1I GCAGC 5 cut(s) 11, 154, 202, 347, 390
BstV2I GAAGAC 1 cut(s) 373
BstXI CCANNNNNNTGG 1 cut(s) 583
BsuI GTATCC 1 cut(s) 524
BsuRI GGCC 2 cut(s) 10, 284
BtsCI GGATG 3 cut(s) 433, 611, 615
BtsI GCAGTG 1 cut(s) 90
BtsIMutI CAGTG 1 cut(s) 90
Cac8I GCNNGC 3 cut(s) 115, 573, 577
CciI TCATGA 1 cut(s) 477
CfoI GCGC 1 cut(s) 147
Cfr13I GGNCC 2 cut(s) 9, 628
CviAII CATG 7 cut(s) 136, 170, 237, 307, 478, 499, 543
DdeI CTNAG 1 cut(s) 660
DpnI GATC 3 cut(s) 128, 342, 605
DpnII GATC 3 cut(s) 126, 340, 603
Eam1104I CTCTTC 2 cut(s) 542, 638
EarI CTCTTC 2 cut(s) 542, 638
Eco130I CCWWGG 1 cut(s) 446
Eco24I GRGCYC 1 cut(s) 119
Eco47I GGWCC 1 cut(s) 628
Eco47III AGCGCT 1 cut(s) 146
EcoT14I CCWWGG 1 cut(s) 446
EcoT22I ATGCAT 1 cut(s) 137
EcoT38I GRGCYC 1 cut(s) 119
ErhI CCWWGG 1 cut(s) 446
FaeI CATG 7 cut(s) 139, 173, 240, 310, 481, 502, 546
FalI AAGNNNNNCTT 2 cut(s) 281, 313
FatI CATG 7 cut(s) 135, 169, 236, 306, 477, 498, 542
Fnu4HI GCNGC 5 cut(s) 25, 143, 191, 361, 379
FokI GGATG 3 cut(s) 420, 598, 602
FriOI GRGCYC 1 cut(s) 119
Fsp4HI GCNGC 5 cut(s) 25, 143, 191, 361, 379
GlaI GCGC 1 cut(s) 146
GluI GCNGC 5 cut(s) 25, 143, 191, 361, 379
HaeII RGCGCY 1 cut(s) 148
HaeIII GGCC 2 cut(s) 10, 284
HapII CCGG 1 cut(s) 440
HhaI GCGC 1 cut(s) 147
Hin1II CATG 7 cut(s) 139, 173, 240, 310, 481, 502, 546
Hin6I GCGC 1 cut(s) 145
HinP1I GCGC 1 cut(s) 145
HpaII CCGG 1 cut(s) 440
HphI GGTGA 3 cut(s) 109, 394, 661
Hpy188III TCNNGA 2 cut(s) 478, 528
HpyAV CCTTC 2 cut(s) 224, 646
HpyCH4IV ACGT 1 cut(s) 269
HpyCH4V TGCA 8 cut(s) 4, 27, 135, 164, 240, 266, 363, 378
HpyF10VI GCNNNNNNNGC 2 cut(s) 257, 469
HpyF3I CTNAG 1 cut(s) 660
HpySE526I ACGT 1 cut(s) 269
Hsp92II CATG 7 cut(s) 139, 173, 240, 310, 481, 502, 546
HspAI GCGC 1 cut(s) 145
Kzo9I GATC 3 cut(s) 126, 340, 603
LpnPI CCDG 8 cut(s) 54, 132, 229, 276, 326, 453, 513, 589
Lsp1109I GCAGC 5 cut(s) 11, 154, 202, 347, 390
MaeII ACGT 1 cut(s) 269
MaeIII GTNAC 1 cut(s) 538
MalI GATC 3 cut(s) 128, 342, 605
MboI GATC 3 cut(s) 126, 340, 603
MboII GAAGA 4 cut(s) 378, 531, 559, 655
MhlI GDGCHC 2 cut(s) 119, 180
MluCI AATT 4 cut(s) 66, 92, 181, 411
MnlI CCTC 8 cut(s) 180, 416, 427, 447, 508, 629, 639, 655
Mph1103I ATGCAT 1 cut(s) 137
MseI TTAA 2 cut(s) 422, 666
MslI CAYNNNNRTG 2 cut(s) 482, 503
MspI CCGG 1 cut(s) 440
MwoI GCNNNNNNNGC 2 cut(s) 257, 469
NdeII GATC 3 cut(s) 126, 340, 603
NlaIII CATG 7 cut(s) 139, 173, 240, 310, 481, 502, 546
NlaIV GGNNCC 2 cut(s) 11, 444
NmuCI GTSAC 1 cut(s) 538
NsiI ATGCAT 1 cut(s) 137
NspI RCATGY 2 cut(s) 139, 173
NspV TTCGAA 1 cut(s) 491
PagI TCATGA 1 cut(s) 477
PciI ACATGT 1 cut(s) 169
PkrI GCNGC 5 cut(s) 26, 144, 192, 362, 380
PscI ACATGT 1 cut(s) 169
PspN4I GGNNCC 2 cut(s) 11, 444
PspPI GGNCC 2 cut(s) 9, 628
PstI CTGCAG 1 cut(s) 365
RseI CAYNNNNRTG 2 cut(s) 482, 503
SaqAI TTAA 2 cut(s) 422, 666
SatI GCNGC 5 cut(s) 25, 143, 191, 361, 379
Sau3AI GATC 3 cut(s) 126, 340, 603
Sau96I GGNCC 2 cut(s) 9, 628
SduI GDGCHC 2 cut(s) 119, 180
SetI ASST 8 cut(s) 235, 253, 272, 320, 362, 419, 661, 666
SfcI CTRYAG 1 cut(s) 361
SfuI TTCGAA 1 cut(s) 491
SinI GGWCC 1 cut(s) 628
SmiMI CAYNNNNRTG 2 cut(s) 482, 503
Sse9I AATT 4 cut(s) 66, 92, 181, 411
SsiI CCGC 2 cut(s) 463, 631
StyI CCWWGG 1 cut(s) 446
TaiI ACGT 1 cut(s) 272
TaqI TCGA 2 cut(s) 149, 491
TasI AATT 4 cut(s) 66, 92, 181, 411
Tru1I TTAA 2 cut(s) 422, 666
Tru9I TTAA 2 cut(s) 422, 666
TscAI CASTG 1 cut(s) 90
TseFI GTSAC 1 cut(s) 538
TseI GCWGC 5 cut(s) 24, 142, 190, 360, 378
Tsp45I GTSAC 1 cut(s) 538
TspDTI ATGAA 3 cut(s) 225, 494, 515
TspGWI ACGGA 1 cut(s) 385
TspRI CASTG 1 cut(s) 90
VpaK11BI GGWCC 1 cut(s) 628
XceI RCATGY 2 cut(s) 139, 173
XcmI CCANNNNNNNNNTGG 1 cut(s) 622
Zsp2I ATGCAT 1 cut(s) 137
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.