pycom15g03480

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
OG0000158
Physical Location & Seq
Forward (+)
2135276 .. 2136551
1276 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom15g03480.3

Sequence Viewer

Length: 864 bp
ATGTTAGGGAGGAGTTTTTACATAAATTGTCACATCCCAGCCCAGGCCCCCACCATATCCCGGGCTCGACTCCACCGTAGCACAATATTGTCCGCTTTGGGCCCCTACCACACCCTCACGGTTTTGTTTCTGGGAACTCACACGAGATCTTCCCAGTGGGTCACCCATCTTGGGAATGCTCTCCCGCGCTACTCGCTTAACTTCGGAGTTCCTACGGAACTCGAATCCAATGAGCTCACAAAAGGTCTCATGCTAGTTAGAGATGAGAATATACATATAAAGCTTACAAGATCCACTCCCCTGGGCGATGTAGGATCACACATCTGGCTAGGGATTGGCTCTGATACCAAATTGTCACATCTCAGCCCCGGCCCCCACCACATCCGGGCTCGACTCCACCGTAGCACGATATTGTTCGAACTCACACGAGAACTTCCTAGTGGGTCACCCATCCTGGGAATGGTCTCGCGCGTTACTCGCTTAACTTCGGAGTTCTTACAAAACCTGAAGCCAATGAGTTCCCAAAAGGCCTCGATCCACTCCCCGGGACGTTGTGGGATGTTACATAAATTAGATGGAAATGTCTTTAATTGGCTAACGAAGATAAACACAAGGACCAAATTGGACCATTTTAACATTTCTACATTAAATTTTTTAAAAATTAGTATTCGGTCCCTAAATTTGATCGAAGACCCTGATATTACTGTATTAATGAATATACATGTTACATACTCACACTTTATTAAACTCCTAATTAATTTTCAATTCAAAACATTTGAAAACAAAAAAAAAATTAGAAAACTTAAATGTTCCCACTCATTTAATTTTTTAATTTTTTTTAATCATAAATGTACTCATTCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

288

Amino Acids

32.67

Weight (kDa)

10.29

Isoelectric Point (pI)

46.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 3 cut(s) 187, 469, 471
AciI CCGC 2 cut(s) 93, 185
AclWI GGATC 3 cut(s) 285, 322, 529
AcsI RAATTY 2 cut(s) 649, 679
AcuI CTGAAG 1 cut(s) 527
AfaI GTAC 1 cut(s) 853
AfiI CCNNNNNNNGG 7 cut(s) 43, 60, 171, 385, 455, 460, 544
AflIII ACRYGT 1 cut(s) 721
AgsI TTSAA 3 cut(s) 764, 769, 779
AjnI CCWGG 3 cut(s) 42, 300, 453
AluBI AGCT 2 cut(s) 235, 283
AluI AGCT 2 cut(s) 235, 283
Alw21I GWGCWC 1 cut(s) 237
Alw26I GTCTC 2 cut(s) 251, 469
AlwI GGATC 3 cut(s) 285, 322, 529
Ama87I CYCGRG 2 cut(s) 60, 544
AoxI GGCC 4 cut(s) 45, 100, 370, 528
ApaI GGGCCC 1 cut(s) 104
ApoI RAATTY 2 cut(s) 649, 679
AseI ATTAAT 2 cut(s) 710, 756
AspLEI GCGC 2 cut(s) 189, 471
AspS9I GGNCC 7 cut(s) 46, 100, 101, 371, 615, 625, 672
AsuC2I CCSGG 6 cut(s) 61, 62, 369, 386, 545, 546
AsuHPI GGTGA 2 cut(s) 154, 438
AsuII TTCGAA 1 cut(s) 417
AvaI CYCGRG 2 cut(s) 60, 544
AvaII GGWCC 3 cut(s) 615, 625, 672
BaeGI GKGCMC 1 cut(s) 104
BanII GRGCYC 4 cut(s) 67, 104, 237, 391
BauI CACGAG 2 cut(s) 142, 426
BbsI GAAGAC 1 cut(s) 696
Bbv12I GWGCWC 1 cut(s) 237
BccI CCATC 3 cut(s) 174, 458, 569
BciT130I CCWGG 3 cut(s) 44, 302, 455
BcnI CCSGG 6 cut(s) 61, 62, 369, 386, 545, 546
BcoDI GTCTC 2 cut(s) 251, 469
BfaI CTAG 3 cut(s) 254, 329, 438
BglII AGATCT 1 cut(s) 146
Bme1390I CCNGG 9 cut(s) 44, 61, 62, 302, 369, 386, 455, 545, 546
Bme18I GGWCC 3 cut(s) 615, 625, 672
BmeT110I CYCGRG 2 cut(s) 60, 544
BmgT120I GGNCC 7 cut(s) 46, 100, 101, 371, 615, 625, 672
BmiI GGNNCC 5 cut(s) 48, 102, 103, 373, 674
BmrFI CCNGG 9 cut(s) 44, 61, 62, 302, 369, 386, 455, 545, 546
BmrI ACTGGG 1 cut(s) 148
BmuI ACTGGG 1 cut(s) 148
BpiI GAAGAC 1 cut(s) 696
Bpu14I TTCGAA 1 cut(s) 417
BpuMI CCSGG 6 cut(s) 61, 62, 369, 386, 545, 546
BsaI GGTCTC 2 cut(s) 251, 469
BsaJI CCNNGG 8 cut(s) 42, 60, 300, 301, 367, 454, 543, 544
Bsc4I CCNNNNNNNGG 7 cut(s) 43, 60, 171, 385, 455, 460, 544
Bse1I ACTGG 1 cut(s) 154
BseBI CCWGG 3 cut(s) 44, 302, 455
BseDI CCNNGG 8 cut(s) 42, 60, 300, 301, 367, 454, 543, 544
BseGI GGATG 4 cut(s) 33, 381, 450, 564
BseLI CCNNNNNNNGG 7 cut(s) 43, 60, 171, 385, 455, 460, 544
BseMII CTCAG 1 cut(s) 376
BseNI ACTGG 1 cut(s) 154
BseRI GAGGAG 1 cut(s) 25
BseSI GKGCMC 1 cut(s) 104
BseYI CCCAGC 1 cut(s) 37
Bsh1236I CGCG 3 cut(s) 187, 469, 471
BshFI GGCC 4 cut(s) 47, 102, 372, 530
BsiHKAI GWGCWC 1 cut(s) 237
BsiHKCI CYCGRG 2 cut(s) 60, 544
BsiSI CCGG 4 cut(s) 61, 369, 385, 545
BslFI GGGAC 2 cut(s) 561, 658
BslI CCNNNNNNNGG 7 cut(s) 43, 60, 171, 385, 455, 460, 544
BsmAI GTCTC 2 cut(s) 251, 469
BsmFI GGGAC 2 cut(s) 561, 658
BsmI GAATGC 1 cut(s) 181
BsnI GGCC 4 cut(s) 47, 102, 372, 530
Bso31I GGTCTC 2 cut(s) 251, 469
BsoBI CYCGRG 2 cut(s) 60, 544
Bsp119I TTCGAA 1 cut(s) 417
Bsp120I GGGCCC 1 cut(s) 100
Bsp1286I GDGCHC 4 cut(s) 67, 104, 237, 391
Bsp143I GATC 5 cut(s) 146, 290, 314, 534, 684
BspACI CCGC 2 cut(s) 93, 185
BspANI GGCC 4 cut(s) 47, 102, 372, 530
BspCNI CTCAG 1 cut(s) 375
BspFNI CGCG 3 cut(s) 187, 469, 471
BspLI GGNNCC 5 cut(s) 48, 102, 103, 373, 674
BspPI GGATC 3 cut(s) 285, 322, 529
BspT104I TTCGAA 1 cut(s) 417
BspTNI GGTCTC 2 cut(s) 251, 469
BsrI ACTGG 1 cut(s) 154
BssECI CCNNGG 8 cut(s) 42, 60, 300, 301, 367, 454, 543, 544
BssMI GATC 5 cut(s) 146, 290, 314, 534, 684
BssSI CACGAG 2 cut(s) 142, 426
Bst2BI CACGAG 2 cut(s) 142, 426
Bst2UI CCWGG 3 cut(s) 44, 302, 455
Bst4CI ACNGT 4 cut(s) 77, 121, 401, 706
BstBI TTCGAA 1 cut(s) 417
BstDEI CTNAG 1 cut(s) 362
BstEII GGTNACC 2 cut(s) 160, 444
BstF5I GGATG 4 cut(s) 33, 381, 450, 564
BstFNI CGCG 3 cut(s) 187, 469, 471
BstHHI GCGC 2 cut(s) 189, 471
BstKTI GATC 5 cut(s) 149, 293, 317, 537, 687
BstMAI GTCTC 2 cut(s) 251, 469
BstMBI GATC 5 cut(s) 146, 290, 314, 534, 684
BstMWI GCNNNNNNNGC 2 cut(s) 193, 477
BstNI CCWGG 3 cut(s) 44, 302, 455
BstNSI RCATGY 1 cut(s) 725
BstPI GGTNACC 2 cut(s) 160, 444
BstSCI CCNGG 9 cut(s) 42, 59, 60, 300, 367, 384, 453, 543, 544
BstSLI GKGCMC 1 cut(s) 104
BstUI CGCG 3 cut(s) 187, 469, 471
BstV2I GAAGAC 1 cut(s) 696
BstX2I RGATCY 2 cut(s) 146, 290
BstXI CCANNNNNNTGG 1 cut(s) 301
BstYI RGATCY 2 cut(s) 146, 290
BsuRI GGCC 4 cut(s) 47, 102, 372, 530
BtgZI GCGATG 1 cut(s) 321
BtsCI GGATG 4 cut(s) 33, 381, 450, 564
BtsIMutI CAGTG 1 cut(s) 161
CfoI GCGC 2 cut(s) 189, 471
Cfr13I GGNCC 7 cut(s) 46, 100, 101, 371, 615, 625, 672
Cfr9I CCCGGG 2 cut(s) 60, 544
Csp6I GTAC 1 cut(s) 852
CviAII CATG 2 cut(s) 250, 722
CviQI GTAC 1 cut(s) 852
DdeI CTNAG 1 cut(s) 362
DpnI GATC 5 cut(s) 148, 292, 316, 536, 686
DpnII GATC 5 cut(s) 146, 290, 314, 534, 684
DraI TTTAAA 1 cut(s) 657
Ecl136II GAGCTC 1 cut(s) 235
Eco147I AGGCCT 1 cut(s) 530
Eco24I GRGCYC 4 cut(s) 67, 104, 237, 391
Eco31I GGTCTC 2 cut(s) 251, 469
Eco47I GGWCC 3 cut(s) 615, 625, 672
Eco53kI GAGCTC 1 cut(s) 235
Eco57I CTGAAG 1 cut(s) 527
Eco88I CYCGRG 2 cut(s) 60, 544
Eco91I GGTNACC 2 cut(s) 160, 444
EcoICRI GAGCTC 1 cut(s) 235
EcoO109I RGGNCCY 2 cut(s) 46, 101
EcoO65I GGTNACC 2 cut(s) 160, 444
EcoRII CCWGG 3 cut(s) 42, 300, 453
EcoT38I GRGCYC 4 cut(s) 67, 104, 237, 391
FaeI CATG 2 cut(s) 253, 725
FaqI GGGAC 2 cut(s) 561, 658
FatI CATG 2 cut(s) 249, 721
FauI CCCGC 1 cut(s) 192
FokI GGATG 4 cut(s) 20, 368, 437, 571
FriOI GRGCYC 4 cut(s) 67, 104, 237, 391
FspBI CTAG 3 cut(s) 254, 329, 438
GlaI GCGC 2 cut(s) 188, 470
GsaI CCCAGC 1 cut(s) 41
HaeIII GGCC 4 cut(s) 47, 102, 372, 530
HapII CCGG 4 cut(s) 61, 369, 385, 545
HhaI GCGC 2 cut(s) 189, 471
Hin1II CATG 2 cut(s) 253, 725
Hin6I GCGC 2 cut(s) 187, 469
HinP1I GCGC 2 cut(s) 187, 469
HindIII AAGCTT 1 cut(s) 281
HinfI GANTC 3 cut(s) 69, 224, 393
HpaII CCGG 4 cut(s) 61, 369, 385, 545
HphI GGTGA 2 cut(s) 154, 438
Hpy188I TCNGA 3 cut(s) 206, 343, 490
HpyCH4III ACNGT 4 cut(s) 77, 121, 401, 706
HpyCH4IV ACGT 1 cut(s) 550
HpyF10VI GCNNNNNNNGC 2 cut(s) 193, 477
HpyF3I CTNAG 1 cut(s) 362
HpySE526I ACGT 1 cut(s) 550
Hsp92II CATG 2 cut(s) 253, 725
HspAI GCGC 2 cut(s) 187, 469
Kzo9I GATC 5 cut(s) 146, 290, 314, 534, 684
MaeI CTAG 3 cut(s) 254, 329, 438
MaeII ACGT 1 cut(s) 550
MaeIII GTNAC 7 cut(s) 29, 160, 354, 444, 472, 561, 724
MalI GATC 5 cut(s) 148, 292, 316, 536, 686
MboI GATC 5 cut(s) 146, 290, 314, 534, 684
MboII GAAGA 3 cut(s) 141, 613, 701
MflI RGATCY 2 cut(s) 146, 290
MhlI GDGCHC 4 cut(s) 67, 104, 237, 391
MlyI GAGTC 2 cut(s) 63, 387
MnlI CCTC 3 cut(s) 3, 125, 541
MspI CCGG 4 cut(s) 61, 369, 385, 545
MspR9I CCNGG 9 cut(s) 44, 61, 62, 302, 369, 386, 455, 545, 546
Mva1269I GAATGC 1 cut(s) 181
MvaI CCWGG 3 cut(s) 44, 302, 455
MvnI CGCG 3 cut(s) 187, 469, 471
MwoI GCNNNNNNNGC 2 cut(s) 193, 477
NciI CCSGG 6 cut(s) 61, 62, 369, 386, 545, 546
NdeII GATC 5 cut(s) 146, 290, 314, 534, 684
NlaIII CATG 2 cut(s) 253, 725
NlaIV GGNNCC 5 cut(s) 48, 102, 103, 373, 674
NmuCI GTSAC 4 cut(s) 29, 160, 354, 444
NspI RCATGY 1 cut(s) 725
NspV TTCGAA 1 cut(s) 417
PasI CCCWGGG 1 cut(s) 301
PceI AGGCCT 1 cut(s) 530
PciI ACATGT 1 cut(s) 721
PcsI WCGNNNNNNNCGW 2 cut(s) 73, 397
PctI GAATGC 1 cut(s) 181
PfeI GAWTC 1 cut(s) 224
PleI GAGTC 2 cut(s) 63, 387
PpsI GAGTC 2 cut(s) 63, 387
PscI ACATGT 1 cut(s) 721
PshBI ATTAAT 2 cut(s) 710, 756
Psp124BI GAGCTC 1 cut(s) 237
Psp6I CCWGG 3 cut(s) 42, 300, 453
PspEI GGTNACC 2 cut(s) 160, 444
PspFI CCCAGC 1 cut(s) 37
PspGI CCWGG 3 cut(s) 42, 300, 453
PspN4I GGNNCC 5 cut(s) 48, 102, 103, 373, 674
PspOMI GGGCCC 1 cut(s) 100
PspPI GGNCC 7 cut(s) 46, 100, 101, 371, 615, 625, 672
PsuI RGATCY 2 cut(s) 146, 290
RsaI GTAC 1 cut(s) 853
RsaNI GTAC 1 cut(s) 852
SacI GAGCTC 1 cut(s) 237
Sau3AI GATC 5 cut(s) 146, 290, 314, 534, 684
Sau96I GGNCC 7 cut(s) 46, 100, 101, 371, 615, 625, 672
SchI GAGTC 2 cut(s) 63, 387
ScrFI CCNGG 9 cut(s) 44, 61, 62, 302, 369, 386, 455, 545, 546
SduI GDGCHC 4 cut(s) 67, 104, 237, 391
SetI ASST 5 cut(s) 237, 247, 285, 507, 553
SfuI TTCGAA 1 cut(s) 417
SinI GGWCC 3 cut(s) 615, 625, 672
SmaI CCCGGG 2 cut(s) 62, 546
SseBI AGGCCT 1 cut(s) 530
SsiI CCGC 2 cut(s) 93, 185
SspI AATATT 1 cut(s) 87
SspMI CTAG 3 cut(s) 254, 329, 438
SstI GAGCTC 1 cut(s) 237
StuI AGGCCT 1 cut(s) 530
StyD4I CCNGG 9 cut(s) 42, 59, 60, 300, 367, 384, 453, 543, 544
TaaI ACNGT 4 cut(s) 77, 121, 401, 706
TaiI ACGT 1 cut(s) 553
TaqI TCGA 6 cut(s) 67, 222, 391, 417, 533, 687
TaqII GACCGA 1 cut(s) 660
TatI WGTACW 1 cut(s) 851
TfiI GAWTC 1 cut(s) 224
TscAI CASTG 1 cut(s) 161
TseFI GTSAC 4 cut(s) 29, 160, 354, 444
Tsp45I GTSAC 4 cut(s) 29, 160, 354, 444
TspDTI ATGAA 1 cut(s) 728
TspGWI ACGGA 1 cut(s) 230
TspMI CCCGGG 2 cut(s) 60, 544
TspRI CASTG 1 cut(s) 161
VpaK11BI GGWCC 3 cut(s) 615, 625, 672
VspI ATTAAT 2 cut(s) 710, 756
XapI RAATTY 2 cut(s) 649, 679
XceI RCATGY 1 cut(s) 725
XcmI CCANNNNNNNNNTGG 1 cut(s) 457
XmaI CCCGGG 2 cut(s) 60, 544
XspI CTAG 3 cut(s) 254, 329, 438
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.