pycom12g16750

Receptor-like protein 2

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
OG0000158
Physical Location & Seq
Forward (+)
19055830 .. 19056836
1007 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12g16750.5

Sequence Viewer

Length: 786 bp
ATGATATTTTTTGAAATTTTGATTGATAATTTTCATAACAAAATTGTACATACCAAAGTTAAGTTAACACATTGTACCAATACCATGGTACATACTAAAACAAGAAAAATGTCACATCCCGGCCCGGGGGGGGACCACATCCCGGGCCCGCTCCACCACCGTAGCACGATATTGTCCGCTTTGGGCTTACCATTCCCTCACGGTTTTGTTTTCGGGAACTCACGAGCAACTTCCCAGTGGGTCACCCATCATGGGATTGCTCTAGCCCCCTTCTCGCTTAACTTCGGAGTTCCTACGGAACCCGAAGCCAGTGAGCTCCCAAAATGCCTCGTGTTAGGTAGGGATGGGAATATACATACAAGGATCACTCCCCTGGGCGATGTGGGATGTCACAATCCACCCCCCTTAGGGGCCCGACACCAAATTGTTACATCCCGGCTCGGGGGGGACCACTTCCCGGGCCCGCTCCACCACCGTAGCACGATATTGTCCGCTTTGGCAACTTCCCAGTGGGTCACCCATCATGGGATTGTTCTAGCCCCCTTCTCGCTTAACTTCAGAGTTCCTACGGAACCCGAAGCCAGTGAGCTCCCAAAAGGCCTCGTGCTAGGTAGGGATGAGAATATACATATAAGGATCACTCCCTTGGGCGATGTGGGATGTCACAAAAAACATAACGTACCAAAATTAGTAGTATGTACCGATTATGTACCAAGTTATTGGTATGTTATGTTTGTTAGTTGTATTTTTAGACTTTTAATGATATTTTTTGAAAATTTTGATTGA

Protein Analysis

262

Amino Acids

28.98

Weight (kDa)

8.79

Isoelectric Point (pI)

48.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 2 cut(s) 151, 466
AciI CCGC 4 cut(s) 149, 177, 464, 492
AclWI GGATC 2 cut(s) 371, 644
AcsI RAATTY 2 cut(s) 15, 775
AcuI CTGAAG 1 cut(s) 541
AfaI GTAC 6 cut(s) 48, 76, 90, 681, 700, 711
AgsI TTSAA 2 cut(s) 14, 773
AjnI CCWGG 1 cut(s) 372
AluBI AGCT 2 cut(s) 316, 589
AluI AGCT 2 cut(s) 316, 589
Alw21I GWGCWC 2 cut(s) 318, 591
AlwI GGATC 2 cut(s) 371, 644
Ama87I CYCGRG 4 cut(s) 124, 142, 440, 457
AoxI GGCC 5 cut(s) 121, 145, 411, 460, 598
ApaI GGGCCC 3 cut(s) 149, 415, 464
ApoI RAATTY 2 cut(s) 15, 775
AspS9I GGNCC 9 cut(s) 122, 133, 145, 146, 411, 412, 448, 460, 461
AsuC2I CCSGG 8 cut(s) 120, 125, 126, 143, 144, 436, 458, 459
AsuHPI GGTGA 2 cut(s) 235, 508
AvaI CYCGRG 4 cut(s) 124, 142, 440, 457
AvaII GGWCC 2 cut(s) 133, 448
AxyI CCTNAGG 1 cut(s) 406
BaeGI GKGCMC 3 cut(s) 149, 415, 464
BanII GRGCYC 5 cut(s) 149, 318, 415, 464, 591
BauI CACGAG 3 cut(s) 222, 329, 602
Bbv12I GWGCWC 2 cut(s) 318, 591
BccI CCATC 3 cut(s) 255, 338, 528
BciT130I CCWGG 1 cut(s) 374
BcnI CCSGG 8 cut(s) 120, 125, 126, 143, 144, 436, 458, 459
BfaI CTAG 3 cut(s) 263, 536, 608
Bme1390I CCNGG 9 cut(s) 120, 125, 126, 143, 144, 374, 436, 458, 459
Bme18I GGWCC 2 cut(s) 133, 448
BmeT110I CYCGRG 4 cut(s) 124, 142, 440, 457
BmgT120I GGNCC 9 cut(s) 122, 133, 145, 146, 411, 412, 448, 460, 461
BmiI GGNNCC 8 cut(s) 134, 147, 300, 412, 413, 449, 462, 573
BmrFI CCNGG 9 cut(s) 120, 125, 126, 143, 144, 374, 436, 458, 459
BmrI ACTGGG 2 cut(s) 229, 502
BmuI ACTGGG 2 cut(s) 229, 502
BpuMI CCSGG 8 cut(s) 120, 125, 126, 143, 144, 436, 458, 459
BsaJI CCNNGG 8 cut(s) 84, 124, 125, 142, 372, 373, 457, 645
Bse1I ACTGG 4 cut(s) 235, 309, 508, 582
Bse21I CCTNAGG 1 cut(s) 406
BseBI CCWGG 1 cut(s) 374
BseDI CCNNGG 8 cut(s) 84, 124, 125, 142, 372, 373, 457, 645
BseGI GGATG 7 cut(s) 115, 138, 349, 392, 431, 622, 665
BseNI ACTGG 4 cut(s) 235, 309, 508, 582
BseSI GKGCMC 3 cut(s) 149, 415, 464
BshFI GGCC 5 cut(s) 123, 147, 413, 462, 600
BsiHKAI GWGCWC 2 cut(s) 318, 591
BsiHKCI CYCGRG 4 cut(s) 124, 142, 440, 457
BsiSI CCGG 5 cut(s) 120, 125, 143, 436, 458
BslFI GGGAC 2 cut(s) 146, 461
BsmFI GGGAC 2 cut(s) 146, 461
BsnI GGCC 5 cut(s) 123, 147, 413, 462, 600
BsoBI CYCGRG 4 cut(s) 124, 142, 440, 457
Bsp120I GGGCCC 3 cut(s) 145, 411, 460
Bsp1286I GDGCHC 5 cut(s) 149, 318, 415, 464, 591
Bsp1407I TGTACA 1 cut(s) 46
Bsp143I GATC 2 cut(s) 363, 636
Bsp19I CCATGG 1 cut(s) 84
BspACI CCGC 4 cut(s) 149, 177, 464, 492
BspANI GGCC 5 cut(s) 123, 147, 413, 462, 600
BspLI GGNNCC 8 cut(s) 134, 147, 300, 412, 413, 449, 462, 573
BspPI GGATC 2 cut(s) 371, 644
BsrBI CCGCTC 2 cut(s) 151, 466
BsrGI TGTACA 1 cut(s) 46
BsrI ACTGG 4 cut(s) 235, 309, 508, 582
BssECI CCNNGG 8 cut(s) 84, 124, 125, 142, 372, 373, 457, 645
BssMI GATC 2 cut(s) 363, 636
BssSI CACGAG 3 cut(s) 222, 329, 602
BssT1I CCWWGG 2 cut(s) 84, 645
Bst2BI CACGAG 3 cut(s) 222, 329, 602
Bst2UI CCWGG 1 cut(s) 374
Bst4CI ACNGT 3 cut(s) 161, 203, 476
BstAUI TGTACA 1 cut(s) 46
BstC8I GCNNGC 2 cut(s) 149, 464
BstDEI CTNAG 1 cut(s) 406
BstDSI CCRYGG 1 cut(s) 84
BstEII GGTNACC 2 cut(s) 241, 514
BstF5I GGATG 7 cut(s) 115, 138, 349, 392, 431, 622, 665
BstKTI GATC 2 cut(s) 366, 639
BstMBI GATC 2 cut(s) 363, 636
BstNI CCWGG 1 cut(s) 374
BstPI GGTNACC 2 cut(s) 241, 514
BstSCI CCNGG 9 cut(s) 118, 123, 124, 141, 142, 372, 434, 456, 457
BstSLI GKGCMC 3 cut(s) 149, 415, 464
BstXI CCANNNNNNTGG 2 cut(s) 85, 720
Bsu36I CCTNAGG 1 cut(s) 406
BsuRI GGCC 5 cut(s) 123, 147, 413, 462, 600
BtgI CCRYGG 1 cut(s) 84
BtgZI GCGATG 2 cut(s) 393, 666
BtsCI GGATG 7 cut(s) 115, 138, 349, 392, 431, 622, 665
BtsIMutI CAGTG 4 cut(s) 242, 316, 515, 589
Cac8I GCNNGC 2 cut(s) 149, 464
Cfr13I GGNCC 9 cut(s) 122, 133, 145, 146, 411, 412, 448, 460, 461
Cfr9I CCCGGG 3 cut(s) 124, 142, 457
Csp6I GTAC 6 cut(s) 47, 75, 89, 680, 699, 710
CviAII CATG 3 cut(s) 85, 251, 524
CviQI GTAC 6 cut(s) 47, 75, 89, 680, 699, 710
DdeI CTNAG 1 cut(s) 406
DpnI GATC 2 cut(s) 365, 638
DpnII GATC 2 cut(s) 363, 636
Ecl136II GAGCTC 2 cut(s) 316, 589
Eco130I CCWWGG 2 cut(s) 84, 645
Eco147I AGGCCT 1 cut(s) 600
Eco24I GRGCYC 5 cut(s) 149, 318, 415, 464, 591
Eco47I GGWCC 2 cut(s) 133, 448
Eco53kI GAGCTC 2 cut(s) 316, 589
Eco57I CTGAAG 1 cut(s) 541
Eco81I CCTNAGG 1 cut(s) 406
Eco88I CYCGRG 4 cut(s) 124, 142, 440, 457
Eco91I GGTNACC 2 cut(s) 241, 514
EcoICRI GAGCTC 2 cut(s) 316, 589
EcoO109I RGGNCCY 1 cut(s) 411
EcoO65I GGTNACC 2 cut(s) 241, 514
EcoRII CCWGG 1 cut(s) 372
EcoT14I CCWWGG 2 cut(s) 84, 645
EcoT38I GRGCYC 5 cut(s) 149, 318, 415, 464, 591
ErhI CCWWGG 2 cut(s) 84, 645
FaeI CATG 3 cut(s) 88, 254, 527
FaqI GGGAC 2 cut(s) 146, 461
FatI CATG 3 cut(s) 84, 250, 523
FauI CCCGC 2 cut(s) 156, 471
FokI GGATG 7 cut(s) 102, 125, 356, 399, 418, 629, 672
FriOI GRGCYC 5 cut(s) 149, 318, 415, 464, 591
FspBI CTAG 3 cut(s) 263, 536, 608
HaeIII GGCC 5 cut(s) 123, 147, 413, 462, 600
HapII CCGG 5 cut(s) 120, 125, 143, 436, 458
Hin1II CATG 3 cut(s) 88, 254, 527
HincII GTYRAC 1 cut(s) 66
HindII GTYRAC 1 cut(s) 66
HpaI GTTAAC 1 cut(s) 66
HpaII CCGG 5 cut(s) 120, 125, 143, 436, 458
HphI GGTGA 2 cut(s) 235, 508
Hpy166II GTNNAC 1 cut(s) 66
Hpy188I TCNGA 2 cut(s) 287, 560
Hpy188III TCNNGA 2 cut(s) 214, 222
Hpy8I GTNNAC 1 cut(s) 66
HpyAV CCTTC 2 cut(s) 280, 553
HpyCH4III ACNGT 3 cut(s) 161, 203, 476
HpyCH4IV ACGT 1 cut(s) 678
HpyF3I CTNAG 1 cut(s) 406
HpySE526I ACGT 1 cut(s) 678
Hsp92II CATG 3 cut(s) 88, 254, 527
KspAI GTTAAC 1 cut(s) 66
Kzo9I GATC 2 cut(s) 363, 636
LmnI GCTCC 4 cut(s) 156, 321, 471, 594
MaeI CTAG 3 cut(s) 263, 536, 608
MaeII ACGT 1 cut(s) 678
MaeIII GTNAC 6 cut(s) 111, 241, 389, 427, 514, 662
MalI GATC 2 cut(s) 365, 638
MbiI CCGCTC 2 cut(s) 151, 466
MboI GATC 2 cut(s) 363, 636
MhlI GDGCHC 5 cut(s) 149, 318, 415, 464, 591
MluCI AATT 6 cut(s) 15, 28, 42, 423, 686, 775
MnlI CCTC 3 cut(s) 207, 338, 611
MseI TTAA 5 cut(s) 60, 65, 279, 552, 758
MspI CCGG 5 cut(s) 120, 125, 143, 436, 458
MspR9I CCNGG 9 cut(s) 120, 125, 126, 143, 144, 374, 436, 458, 459
MvaI CCWGG 1 cut(s) 374
NciI CCSGG 8 cut(s) 120, 125, 126, 143, 144, 436, 458, 459
NcoI CCATGG 1 cut(s) 84
NdeII GATC 2 cut(s) 363, 636
NlaIII CATG 3 cut(s) 88, 254, 527
NlaIV GGNNCC 8 cut(s) 134, 147, 300, 412, 413, 449, 462, 573
NmuCI GTSAC 5 cut(s) 111, 241, 389, 514, 662
PasI CCCWGGG 1 cut(s) 373
PceI AGGCCT 1 cut(s) 600
Psp124BI GAGCTC 2 cut(s) 318, 591
Psp6I CCWGG 1 cut(s) 372
PspEI GGTNACC 2 cut(s) 241, 514
PspGI CCWGG 1 cut(s) 372
PspN4I GGNNCC 8 cut(s) 134, 147, 300, 412, 413, 449, 462, 573
PspOMI GGGCCC 3 cut(s) 145, 411, 460
PspPI GGNCC 9 cut(s) 122, 133, 145, 146, 411, 412, 448, 460, 461
RsaI GTAC 6 cut(s) 48, 76, 90, 681, 700, 711
RsaNI GTAC 6 cut(s) 47, 75, 89, 680, 699, 710
SacI GAGCTC 2 cut(s) 318, 591
SaqAI TTAA 5 cut(s) 60, 65, 279, 552, 758
Sau3AI GATC 2 cut(s) 363, 636
Sau96I GGNCC 9 cut(s) 122, 133, 145, 146, 411, 412, 448, 460, 461
ScrFI CCNGG 9 cut(s) 120, 125, 126, 143, 144, 374, 436, 458, 459
SduI GDGCHC 5 cut(s) 149, 318, 415, 464, 591
SetI ASST 5 cut(s) 318, 340, 591, 613, 681
SinI GGWCC 2 cut(s) 133, 448
SmaI CCCGGG 3 cut(s) 126, 144, 459
Sse9I AATT 6 cut(s) 15, 28, 42, 423, 686, 775
SseBI AGGCCT 1 cut(s) 600
SsiI CCGC 4 cut(s) 149, 177, 464, 492
SspMI CTAG 3 cut(s) 263, 536, 608
SstI GAGCTC 2 cut(s) 318, 591
StuI AGGCCT 1 cut(s) 600
StyD4I CCNGG 9 cut(s) 118, 123, 124, 141, 142, 372, 434, 456, 457
StyI CCWWGG 2 cut(s) 84, 645
TaaI ACNGT 3 cut(s) 161, 203, 476
TaiI ACGT 1 cut(s) 681
TasI AATT 6 cut(s) 15, 28, 42, 423, 686, 775
TatI WGTACW 1 cut(s) 46
Tru1I TTAA 5 cut(s) 60, 65, 279, 552, 758
Tru9I TTAA 5 cut(s) 60, 65, 279, 552, 758
TscAI CASTG 4 cut(s) 242, 316, 515, 589
TseFI GTSAC 5 cut(s) 111, 241, 389, 514, 662
Tsp45I GTSAC 5 cut(s) 111, 241, 389, 514, 662
TspDTI ATGAA 1 cut(s) 23
TspGWI ACGGA 2 cut(s) 311, 584
TspMI CCCGGG 3 cut(s) 124, 142, 457
TspRI CASTG 4 cut(s) 242, 316, 515, 589
VpaK11BI GGWCC 2 cut(s) 133, 448
XapI RAATTY 2 cut(s) 15, 775
XmaI CCCGGG 3 cut(s) 124, 142, 457
XspI CTAG 3 cut(s) 263, 536, 608
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.