pycom17g18250

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
Physical Location & Seq
Forward (+)
15673041 .. 15674667
1627 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom17g18250.1

Sequence Viewer

Length: 1149 bp
ATGAAATCTTATACTAATTTACCTACAAAAATTAATTTACCTATATTTTCCAGATTCAAAAATTTGATACCAGGTGCATTATTTTTCAAAATAACCAAAATTATTAGCTATGTCACATCCCGGCCCGGGGCGGATCACTTCCCAGGCCCGCTCCACCACCACCACCACCGTAGCACGATATTGTCCGCTTTGGGCTTACCATTCACTCACGGTTTTGTTTTTGGGAACTCACGAGCAACTTCCCAGTGGGTCACCCATCATGGGATTGCTCTAGCCTCCTTCTCGCTTAACTTCGGAGTTCCTACGGAACCCGAAGCCAGTGAGCTCCCAAAAGGCCTCGTGCTAGGTAGGGATGGGAATATACATTTAAGGATTACTCCCCTGGGCGATGTGGGATGTCACATGCTAGACACGTCATTTTTTTACCCTTTTTTGTTACTGACATTCCAAAAATTTCATTCTACACTTCTCACAAGTGTATTTTTCTTTCCTAATATAGAACATTTGGAGTGTAGAATGAGATTTTTGGAGTTGTTGAATTCAAAACGTTTTGAATTTTTATTCTTACATCAATTAAAATTTCGAAGCCTATACACACGTTACAATAAAATAAAAAATGAGGGTAATTTGGGGAATCCGAATAATATTAAATATGACGCACAATCTCGATTAGGTAATTTGCTTAGATGGAGCTTAGTCATCGGGTTTTTGTTAGAAAAATATATTAGGGTTTTATGTAAAAAAAAATTGATATTAAAAACAATGATAGAAAACACCTTGAAATACAAATTGTCAAAGCCTAGCAAAGTTCTCCAAATGTGTTCCTTTCCTCTCCTTCTAATTAAAATCCTTACTAGAAAAGACATTCCTATTCTAACTTTGGGAGATCTGTCCAGCCACAAATCAGCCACGTTTTTGGACTTCCAGGATATCCCGAACATAATTGCAGAAGGTCTCGAACCCAAAAGACACCATCTTGAATGCCAAAAAGCCCAAATAAGTTCAAAACATCAATTTGACAGCATTACATGCTGCTTCTTAATTTCATCCACTCCAAAATTCGTCTGTTTGATAACGTTTTCTTTCAGAGGAAGTCAAATATCATACATTAAAAATATAAATCAAAGTATCAAAATTCTCACAAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

383

Amino Acids

43.77

Weight (kDa)

9.86

Isoelectric Point (pI)

40.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 151
AciI CCGC 3 cut(s) 131, 149, 186
AclI AACGTT 2 cut(s) 547, 1076
AclWI GGATC 1 cut(s) 141
AcsI RAATTY 7 cut(s) 61, 452, 538, 554, 578, 1058, 1134
AfiI CCNNNNNNNGG 3 cut(s) 126, 127, 261
AflIII ACRYGT 2 cut(s) 411, 596
AgsI TTSAA 8 cut(s) 58, 88, 538, 543, 554, 781, 980, 1005
AjiI CACGTC 1 cut(s) 414
AjnI CCWGG 4 cut(s) 70, 142, 381, 924
AluBI AGCT 3 cut(s) 108, 325, 693
AluI AGCT 3 cut(s) 108, 325, 693
Alw21I GWGCWC 1 cut(s) 327
Alw26I GTCTC 1 cut(s) 959
AlwI GGATC 1 cut(s) 141
Ama87I CYCGRG 1 cut(s) 125
AoxI GGCC 3 cut(s) 122, 145, 334
ApeKI GCWGC 1 cut(s) 1032
ApoI RAATTY 7 cut(s) 61, 452, 538, 554, 578, 1058, 1134
AseI ATTAAT 1 cut(s) 33
AspS9I GGNCC 2 cut(s) 123, 146
AsuC2I CCSGG 3 cut(s) 121, 126, 127
AsuHPI GGTGA 1 cut(s) 244
AsuII TTCGAA 1 cut(s) 583
AvaI CYCGRG 1 cut(s) 125
BanII GRGCYC 1 cut(s) 327
BauI CACGAG 2 cut(s) 231, 338
Bbv12I GWGCWC 1 cut(s) 327
BbvI GCAGC 1 cut(s) 1019
BccI CCATC 4 cut(s) 264, 347, 681, 981
BciT130I CCWGG 4 cut(s) 72, 144, 383, 926
BcnI CCSGG 3 cut(s) 121, 126, 127
BcoDI GTCTC 1 cut(s) 959
BfaI CTAG 5 cut(s) 272, 344, 407, 801, 855
BglII AGATCT 1 cut(s) 886
BisI GCNGC 1 cut(s) 1033
BlsI GCNGC 1 cut(s) 1034
Bme1390I CCNGG 7 cut(s) 72, 121, 126, 127, 144, 383, 926
BmeT110I CYCGRG 1 cut(s) 125
BmgBI CACGTC 1 cut(s) 414
BmgT120I GGNCC 2 cut(s) 123, 146
BmiI GGNNCC 1 cut(s) 309
BmrFI CCNGG 7 cut(s) 72, 121, 126, 127, 144, 383, 926
BmrI ACTGGG 1 cut(s) 238
BmuI ACTGGG 1 cut(s) 238
Bpu14I TTCGAA 1 cut(s) 583
BpuMI CCSGG 3 cut(s) 121, 126, 127
BsaI GGTCTC 1 cut(s) 959
BsaJI CCNNGG 5 cut(s) 125, 126, 142, 381, 382
Bsc4I CCNNNNNNNGG 3 cut(s) 126, 127, 261
Bse1I ACTGG 2 cut(s) 244, 318
BseBI CCWGG 4 cut(s) 72, 144, 383, 926
BseDI CCNNGG 5 cut(s) 125, 126, 142, 381, 382
BseGI GGATG 4 cut(s) 116, 358, 401, 1046
BseLI CCNNNNNNNGG 3 cut(s) 126, 127, 261
BseNI ACTGG 2 cut(s) 244, 318
BseXI GCAGC 1 cut(s) 1019
BshFI GGCC 3 cut(s) 124, 147, 336
BsiHKAI GWGCWC 1 cut(s) 327
BsiHKCI CYCGRG 1 cut(s) 125
BsiSI CCGG 2 cut(s) 121, 126
BslI CCNNNNNNNGG 3 cut(s) 126, 127, 261
BsmAI GTCTC 1 cut(s) 959
BsmI GAATGC 1 cut(s) 986
BsnI GGCC 3 cut(s) 124, 147, 336
Bso31I GGTCTC 1 cut(s) 959
BsoBI CYCGRG 1 cut(s) 125
Bsp119I TTCGAA 1 cut(s) 583
Bsp1286I GDGCHC 1 cut(s) 327
Bsp143I GATC 2 cut(s) 133, 886
BspACI CCGC 3 cut(s) 131, 149, 186
BspANI GGCC 3 cut(s) 124, 147, 336
BspLI GGNNCC 1 cut(s) 309
BspPI GGATC 1 cut(s) 141
BspT104I TTCGAA 1 cut(s) 583
BspTNI GGTCTC 1 cut(s) 959
BsrBI CCGCTC 1 cut(s) 151
BsrI ACTGG 2 cut(s) 244, 318
BssECI CCNNGG 5 cut(s) 125, 126, 142, 381, 382
BssMI GATC 2 cut(s) 133, 886
BssSI CACGAG 2 cut(s) 231, 338
Bst2BI CACGAG 2 cut(s) 231, 338
Bst2UI CCWGG 4 cut(s) 72, 144, 383, 926
Bst4CI ACNGT 2 cut(s) 170, 212
BstAPI GCANNNNNTGC 1 cut(s) 1029
BstBI TTCGAA 1 cut(s) 583
BstC8I GCNNGC 1 cut(s) 149
BstDEI CTNAG 2 cut(s) 683, 694
BstEII GGTNACC 1 cut(s) 250
BstF5I GGATG 4 cut(s) 116, 358, 401, 1046
BstKTI GATC 2 cut(s) 136, 889
BstMAI GTCTC 1 cut(s) 959
BstMBI GATC 2 cut(s) 133, 886
BstMWI GCNNNNNNNGC 1 cut(s) 1029
BstNI CCWGG 4 cut(s) 72, 144, 383, 926
BstNSI RCATGY 2 cut(s) 406, 1032
BstPI GGTNACC 1 cut(s) 250
BstSCI CCNGG 7 cut(s) 70, 119, 124, 125, 142, 381, 924
BstV1I GCAGC 1 cut(s) 1019
BstX2I RGATCY 1 cut(s) 886
BstXI CCANNNNNNTGG 1 cut(s) 916
BstYI RGATCY 1 cut(s) 886
BsuRI GGCC 3 cut(s) 124, 147, 336
BtgZI GCGATG 1 cut(s) 402
BtrI CACGTC 1 cut(s) 414
BtsCI GGATG 4 cut(s) 116, 358, 401, 1046
BtsIMutI CAGTG 2 cut(s) 251, 325
Cac8I GCNNGC 1 cut(s) 149
Cfr13I GGNCC 2 cut(s) 123, 146
Cfr9I CCCGGG 1 cut(s) 125
CseI GACGC 1 cut(s) 665
CsiI ACCWGGT 1 cut(s) 70
CviAII CATG 3 cut(s) 260, 403, 1029
DdeI CTNAG 2 cut(s) 683, 694
DpnI GATC 2 cut(s) 135, 888
DpnII GATC 2 cut(s) 133, 886
EciI GGCGGA 1 cut(s) 146
Ecl136II GAGCTC 1 cut(s) 325
Eco147I AGGCCT 1 cut(s) 336
Eco24I GRGCYC 1 cut(s) 327
Eco31I GGTCTC 1 cut(s) 959
Eco32I GATATC 1 cut(s) 931
Eco53kI GAGCTC 1 cut(s) 325
Eco88I CYCGRG 1 cut(s) 125
Eco91I GGTNACC 1 cut(s) 250
EcoICRI GAGCTC 1 cut(s) 325
EcoO65I GGTNACC 1 cut(s) 250
EcoRI GAATTC 1 cut(s) 538
EcoRII CCWGG 4 cut(s) 70, 142, 381, 924
EcoRV GATATC 1 cut(s) 931
EcoT38I GRGCYC 1 cut(s) 327
FaeI CATG 3 cut(s) 263, 406, 1032
FatI CATG 3 cut(s) 259, 402, 1028
FauI CCCGC 1 cut(s) 156
Fnu4HI GCNGC 1 cut(s) 1033
FokI GGATG 4 cut(s) 103, 365, 408, 1033
FriOI GRGCYC 1 cut(s) 327
Fsp4HI GCNGC 1 cut(s) 1033
FspBI CTAG 5 cut(s) 272, 344, 407, 801, 855
GluI GCNGC 1 cut(s) 1033
HaeIII GGCC 3 cut(s) 124, 147, 336
HapII CCGG 2 cut(s) 121, 126
HgaI GACGC 1 cut(s) 665
Hin1II CATG 3 cut(s) 263, 406, 1032
HinfI GANTC 2 cut(s) 54, 634
HpaII CCGG 2 cut(s) 121, 126
HphI GGTGA 1 cut(s) 244
Hpy188I TCNGA 3 cut(s) 296, 639, 1088
Hpy188III TCNNGA 6 cut(s) 51, 231, 666, 934, 956, 977
HpyAV CCTTC 3 cut(s) 289, 845, 944
HpyCH4III ACNGT 2 cut(s) 170, 212
HpyCH4IV ACGT 5 cut(s) 413, 547, 598, 911, 1076
HpyCH4V TGCA 2 cut(s) 77, 947
HpyF10VI GCNNNNNNNGC 1 cut(s) 1029
HpyF3I CTNAG 2 cut(s) 683, 694
HpySE526I ACGT 5 cut(s) 413, 547, 598, 911, 1076
Hsp92II CATG 3 cut(s) 263, 406, 1032
Kzo9I GATC 2 cut(s) 133, 886
LmnI GCTCC 3 cut(s) 156, 330, 690
Lsp1109I GCAGC 1 cut(s) 1019
MabI ACCWGGT 1 cut(s) 70
MaeI CTAG 5 cut(s) 272, 344, 407, 801, 855
MaeII ACGT 5 cut(s) 413, 547, 598, 911, 1076
MaeIII GTNAC 5 cut(s) 112, 250, 398, 435, 599
MalI GATC 2 cut(s) 135, 888
MbiI CCGCTC 1 cut(s) 151
MboI GATC 2 cut(s) 133, 886
MflI RGATCY 1 cut(s) 886
MhlI GDGCHC 1 cut(s) 327
MnlI CCTC 5 cut(s) 286, 347, 613, 840, 1082
MseI TTAA 9 cut(s) 33, 288, 368, 575, 648, 755, 843, 1040, 1110
MspI CCGG 2 cut(s) 121, 126
MspR9I CCNGG 7 cut(s) 72, 121, 126, 127, 144, 383, 926
Mva1269I GAATGC 1 cut(s) 986
MvaI CCWGG 4 cut(s) 72, 144, 383, 926
MwoI GCNNNNNNNGC 1 cut(s) 1029
NciI CCSGG 3 cut(s) 121, 126, 127
NdeII GATC 2 cut(s) 133, 886
NlaIII CATG 3 cut(s) 263, 406, 1032
NlaIV GGNNCC 1 cut(s) 309
NmuCI GTSAC 3 cut(s) 112, 250, 398
NspI RCATGY 2 cut(s) 406, 1032
NspV TTCGAA 1 cut(s) 583
PasI CCCWGGG 1 cut(s) 382
PceI AGGCCT 1 cut(s) 336
PctI GAATGC 1 cut(s) 986
PfeI GAWTC 2 cut(s) 54, 634
PfoI TCCNGGA 1 cut(s) 924
PkrI GCNGC 1 cut(s) 1034
PshBI ATTAAT 1 cut(s) 33
Psp124BI GAGCTC 1 cut(s) 327
Psp1406I AACGTT 2 cut(s) 547, 1076
Psp6I CCWGG 4 cut(s) 70, 142, 381, 924
PspEI GGTNACC 1 cut(s) 250
PspGI CCWGG 4 cut(s) 70, 142, 381, 924
PspN4I GGNNCC 1 cut(s) 309
PspPI GGNCC 2 cut(s) 123, 146
PsuI RGATCY 1 cut(s) 886
SacI GAGCTC 1 cut(s) 327
SaqAI TTAA 9 cut(s) 33, 288, 368, 575, 648, 755, 843, 1040, 1110
SatI GCNGC 1 cut(s) 1033
Sau3AI GATC 2 cut(s) 133, 886
Sau96I GGNCC 2 cut(s) 123, 146
ScrFI CCNGG 7 cut(s) 72, 121, 126, 127, 144, 383, 926
SduI GDGCHC 1 cut(s) 327
SexAI ACCWGGT 1 cut(s) 70
SfuI TTCGAA 1 cut(s) 583
SmaI CCCGGG 1 cut(s) 127
SseBI AGGCCT 1 cut(s) 336
SsiI CCGC 3 cut(s) 131, 149, 186
SspI AATATT 1 cut(s) 646
SspMI CTAG 5 cut(s) 272, 344, 407, 801, 855
SstI GAGCTC 1 cut(s) 327
StuI AGGCCT 1 cut(s) 336
StyD4I CCNGG 7 cut(s) 70, 119, 124, 125, 142, 381, 924
TaaI ACNGT 2 cut(s) 170, 212
TaiI ACGT 5 cut(s) 416, 550, 601, 914, 1079
TaqI TCGA 3 cut(s) 583, 667, 957
TfiI GAWTC 2 cut(s) 54, 634
Tru1I TTAA 9 cut(s) 33, 288, 368, 575, 648, 755, 843, 1040, 1110
Tru9I TTAA 9 cut(s) 33, 288, 368, 575, 648, 755, 843, 1040, 1110
TscAI CASTG 2 cut(s) 251, 325
TseFI GTSAC 3 cut(s) 112, 250, 398
TseI GCWGC 1 cut(s) 1032
Tsp45I GTSAC 3 cut(s) 112, 250, 398
TspDTI ATGAA 3 cut(s) 17, 446, 1035
TspGWI ACGGA 1 cut(s) 320
TspMI CCCGGG 1 cut(s) 125
TspRI CASTG 2 cut(s) 251, 325
VspI ATTAAT 1 cut(s) 33
XapI RAATTY 7 cut(s) 61, 452, 538, 554, 578, 1058, 1134
XceI RCATGY 2 cut(s) 406, 1032
XmaI CCCGGG 1 cut(s) 125
XspI CTAG 5 cut(s) 272, 344, 407, 801, 855
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.