pycom12424g00060

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00012424
OG0000158
Physical Location & Seq
Forward (+)
27640 .. 28707
1068 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12424g00060.6

Sequence Viewer

Length: 804 bp
ATGATTAAAACAATGAAAATAATCATCTCCATCATTATTGATAGGAGCATAATTATGCTACTTAGCTATGTTGTTTCCTTCTATTTTCGTATGTTTTTAGGTCCTAATGGCAAAAGCAGCAAGAAAGTGCATTTTGGAGCTATTTGGAGCAGTTTTGGGCCTGGATTGGATAGCTTAACTATAGAGCAAAGTGGATGGACGAAATTGAAGTCAAGAGAGGCTAGGAAAGGTTACAAATCTGGAGAAAGAAGTTCAAATACAAAGAGGATAAGGAAAGAGCAAGAAATAAGGAACATTATCCAACCTTATCCTATCCAATCTTATCTTATCCAACCTTATCTTATCCTAATCTTTTGCTACCTTAATTCCAGTGCCGCACCCTTTATCCCTTCTAGAAGTCAAATTTCTACCATAAAACACATTGTTTCTAGAAACCCTACAAAACCTTTTCCCATTCTTCCTTGGTCTTTGCCGTGGAATCCTAGTCCCTTTTACCCTAGGATTGTCCCTATAAATACAAGTGTTTGCCGCACCATTCAAAGCATCCATTCACTCATTCATTCATTCAAACTTTCAGCCATCAAACACCATAATTCACACATCACCCTAGTGTCGCAAGCAAGGAAGGAAGGAGAAGAAGACTTGTGCAATCTGCCATCCAAAGAGGGTTCGAAATCTGCCATTGGAGTGTGGAGTGTTTCTAGGTGTATTCTATCCTTAGTTTTAGTTCAATTATATGTTTTATATGAATTGATTATATCCAGTTATTGTTCCATAACTCTTGAATGTGATTTGCTTATCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

268

Amino Acids

30.38

Weight (kDa)

9.77

Isoelectric Point (pI)

55.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 375, 529
AcsI RAATTY 1 cut(s) 402
AgsI TTSAA 6 cut(s) 208, 255, 539, 568, 731, 785
AjnI CCWGG 1 cut(s) 160
AleI CACNNNNGTG 1 cut(s) 608
AluBI AGCT 3 cut(s) 66, 140, 174
AluI AGCT 3 cut(s) 66, 140, 174
AoxI GGCC 1 cut(s) 158
ApeKI GCWGC 1 cut(s) 117
ApoI RAATTY 1 cut(s) 402
ArsI GACNNNNNNTTYG 2 cut(s) 194, 226
AspA2I CCTAGG 1 cut(s) 497
AspS9I GGNCC 2 cut(s) 101, 158
AsuHPI GGTGA 1 cut(s) 595
AsuII TTCGAA 1 cut(s) 671
AvaII GGWCC 1 cut(s) 101
AvrII CCTAGG 1 cut(s) 497
BarI GAAGNNNNNNTAC 2 cut(s) 241, 273
BbsI GAAGAC 1 cut(s) 645
BbvI GCAGC 1 cut(s) 129
BccI CCATC 4 cut(s) 38, 189, 587, 664
BceAI ACGGC 1 cut(s) 457
BciT130I CCWGG 1 cut(s) 162
BfaI CTAG 7 cut(s) 222, 393, 429, 483, 498, 608, 702
BfmI CTRYAG 1 cut(s) 180
BisI GCNGC 3 cut(s) 118, 375, 529
BlnI CCTAGG 1 cut(s) 497
BlsI GCNGC 3 cut(s) 119, 376, 530
Bme1390I CCNGG 1 cut(s) 162
Bme18I GGWCC 1 cut(s) 101
BmgT120I GGNCC 2 cut(s) 101, 158
BmrFI CCNGG 1 cut(s) 162
BmsI GCATC 1 cut(s) 552
BpiI GAAGAC 1 cut(s) 645
BpmI CTGGAG 1 cut(s) 261
Bpu14I TTCGAA 1 cut(s) 671
BsaJI CCNNGG 3 cut(s) 461, 473, 497
Bse1I ACTGG 2 cut(s) 369, 762
BseBI CCWGG 1 cut(s) 162
BseDI CCNNGG 3 cut(s) 461, 473, 497
BseGI GGATG 3 cut(s) 200, 543, 656
BseNI ACTGG 2 cut(s) 369, 762
BseXI GCAGC 1 cut(s) 129
BshFI GGCC 1 cut(s) 160
BslFI GGGAC 2 cut(s) 471, 491
BsmFI GGGAC 2 cut(s) 471, 491
BsnI GGCC 1 cut(s) 160
Bsp119I TTCGAA 1 cut(s) 671
BspACI CCGC 2 cut(s) 375, 529
BspANI GGCC 1 cut(s) 160
BspT104I TTCGAA 1 cut(s) 671
BsrI ACTGG 2 cut(s) 369, 762
BssECI CCNNGG 3 cut(s) 461, 473, 497
BssT1I CCWWGG 2 cut(s) 461, 497
Bst2UI CCWGG 1 cut(s) 162
BstBI TTCGAA 1 cut(s) 671
BstC8I GCNNGC 1 cut(s) 618
BstDEI CTNAG 2 cut(s) 62, 718
BstDSI CCRYGG 1 cut(s) 473
BstF5I GGATG 3 cut(s) 200, 543, 656
BstMWI GCNNNNNNNGC 1 cut(s) 117
BstNI CCWGG 1 cut(s) 162
BstSCI CCNGG 1 cut(s) 160
BstSFI CTRYAG 1 cut(s) 180
BstV1I GCAGC 1 cut(s) 129
BstV2I GAAGAC 1 cut(s) 645
BsuRI GGCC 1 cut(s) 160
BtgI CCRYGG 1 cut(s) 473
BtsCI GGATG 3 cut(s) 200, 543, 656
BtsIMutI CAGTG 1 cut(s) 376
Cac8I GCNNGC 1 cut(s) 618
Cfr13I GGNCC 2 cut(s) 101, 158
CviJI RGCY 6 cut(s) 66, 140, 160, 174, 221, 578
CviKI_1 RGCY 6 cut(s) 66, 140, 160, 174, 221, 578
DdeI CTNAG 2 cut(s) 62, 718
Eco130I CCWWGG 2 cut(s) 461, 497
Eco47I GGWCC 1 cut(s) 101
EcoO109I RGGNCCY 1 cut(s) 101
EcoRII CCWGG 1 cut(s) 160
EcoT14I CCWWGG 2 cut(s) 461, 497
ErhI CCWWGG 2 cut(s) 461, 497
FaqI GGGAC 2 cut(s) 471, 491
Fnu4HI GCNGC 3 cut(s) 118, 375, 529
FokI GGATG 3 cut(s) 207, 530, 643
Fsp4HI GCNGC 3 cut(s) 118, 375, 529
FspBI CTAG 7 cut(s) 222, 393, 429, 483, 498, 608, 702
GluI GCNGC 3 cut(s) 118, 375, 529
GsuI CTGGAG 1 cut(s) 261
HaeIII GGCC 1 cut(s) 160
HinfI GANTC 1 cut(s) 478
HphI GGTGA 1 cut(s) 595
Hpy188III TCNNGA 5 cut(s) 213, 240, 393, 429, 782
HpyAV CCTTC 4 cut(s) 88, 399, 619, 623
HpyCH4V TGCA 2 cut(s) 130, 648
HpyF10VI GCNNNNNNNGC 1 cut(s) 117
HpyF3I CTNAG 2 cut(s) 62, 718
LmnI GCTCC 3 cut(s) 45, 137, 147
LpnPI CCDG 5 cut(s) 147, 174, 225, 382, 775
Lsp1109I GCAGC 1 cut(s) 129
LweI GCATC 1 cut(s) 552
MaeI CTAG 7 cut(s) 222, 393, 429, 483, 498, 608, 702
MaeIII GTNAC 1 cut(s) 230
MboII GAAGA 3 cut(s) 449, 647, 650
MluCI AATT 7 cut(s) 51, 203, 364, 402, 592, 731, 749
MmeI TCCRAC 2 cut(s) 325, 355
MnlI CCTC 3 cut(s) 211, 258, 658
MseI TTAA 3 cut(s) 6, 176, 363
MslI CAYNNNNRTG 3 cut(s) 53, 608, 686
MspR9I CCNGG 1 cut(s) 162
MvaI CCWGG 1 cut(s) 162
MwoI GCNNNNNNNGC 1 cut(s) 117
NspV TTCGAA 1 cut(s) 671
OliI CACNNNNGTG 1 cut(s) 608
PfeI GAWTC 1 cut(s) 478
PkrI GCNGC 3 cut(s) 119, 376, 530
PpuMI RGGWCCY 1 cut(s) 101
Psp5II RGGWCCY 1 cut(s) 101
Psp6I CCWGG 1 cut(s) 160
PspGI CCWGG 1 cut(s) 160
PspPI GGNCC 2 cut(s) 101, 158
PspPPI RGGWCCY 1 cut(s) 101
RseI CAYNNNNRTG 3 cut(s) 53, 608, 686
SaqAI TTAA 3 cut(s) 6, 176, 363
SatI GCNGC 3 cut(s) 118, 375, 529
Sau96I GGNCC 2 cut(s) 101, 158
ScrFI CCNGG 1 cut(s) 162
SfaNI GCATC 1 cut(s) 552
SfcI CTRYAG 1 cut(s) 180
SfuI TTCGAA 1 cut(s) 671
SinI GGWCC 1 cut(s) 101
SmiMI CAYNNNNRTG 3 cut(s) 53, 608, 686
Sse9I AATT 7 cut(s) 51, 203, 364, 402, 592, 731, 749
SsiI CCGC 2 cut(s) 375, 529
SspMI CTAG 7 cut(s) 222, 393, 429, 483, 498, 608, 702
StyD4I CCNGG 1 cut(s) 160
StyI CCWWGG 2 cut(s) 461, 497
TaqI TCGA 1 cut(s) 671
TasI AATT 7 cut(s) 51, 203, 364, 402, 592, 731, 749
TauI GCSGC 2 cut(s) 377, 531
TfiI GAWTC 1 cut(s) 478
Tru1I TTAA 3 cut(s) 6, 176, 363
Tru9I TTAA 3 cut(s) 6, 176, 363
TscAI CASTG 1 cut(s) 376
TseI GCWGC 1 cut(s) 117
TspDTI ATGAA 4 cut(s) 29, 548, 552, 762
TspRI CASTG 1 cut(s) 376
VpaK11BI GGWCC 1 cut(s) 101
XapI RAATTY 1 cut(s) 402
XbaI TCTAGA 2 cut(s) 392, 428
XmaJI CCTAGG 1 cut(s) 497
XspI CTAG 7 cut(s) 222, 393, 429, 483, 498, 608, 702
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.