pycom16g14390

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
OG0000158
Physical Location & Seq
Reverse (-)
10439937 .. 10440239
303 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom16g14390.1

Sequence Viewer

Length: 303 bp
ATGTCACATCCCAGCGTGGGGGGGAACCACTTCCCGGGCCCGCTCCACCATCATAGCACGATATTGTCTACTTTGAGTCCCTACCATGCCCTCACGGTTTTATTTCTGGGAACTCACACGAGAACTTCCCGATGGGTCATCCATCCTGGGAATGCTCTCGTGCGCTACTCACTTAACTTCGGAGTCCCCATGGAACCCGAAACCAGTGAGCTCCCAAAAGGCCTCGTGCTAGGTAGGGATGAGAATATACATATAAGGATCACTCCCATGGGCGATGTGGGATGTCACAATCCACCCCCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

101

Amino Acids

10.95

Weight (kDa)

7.17

Isoelectric Point (pI)

52.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 43
AccI GTMKAC 1 cut(s) 68
AciI CCGC 1 cut(s) 41
AclWI GGATC 1 cut(s) 266
AfiI CCNNNNNNNGG 3 cut(s) 17, 18, 34
AjnI CCWGG 1 cut(s) 145
AluBI AGCT 1 cut(s) 211
AluI AGCT 1 cut(s) 211
Alw21I GWGCWC 1 cut(s) 213
AlwI GGATC 1 cut(s) 266
Ama87I CYCGRG 1 cut(s) 34
AoxI GGCC 2 cut(s) 37, 220
ApaI GGGCCC 1 cut(s) 41
Asp700I GAANNNNTTC 1 cut(s) 29
AspLEI GCGC 1 cut(s) 165
AspS9I GGNCC 2 cut(s) 37, 38
AsuC2I CCSGG 2 cut(s) 35, 36
AvaI CYCGRG 1 cut(s) 34
BaeGI GKGCMC 1 cut(s) 41
BanII GRGCYC 2 cut(s) 41, 213
BauI CACGAG 3 cut(s) 118, 158, 224
Bbv12I GWGCWC 1 cut(s) 213
BccI CCATC 3 cut(s) 57, 126, 150
BciT130I CCWGG 1 cut(s) 147
BcnI CCSGG 2 cut(s) 35, 36
BfaI CTAG 1 cut(s) 230
Bme1390I CCNGG 3 cut(s) 35, 36, 147
BmeT110I CYCGRG 1 cut(s) 34
BmgT120I GGNCC 2 cut(s) 37, 38
BmiI GGNNCC 3 cut(s) 26, 39, 195
BmrFI CCNGG 3 cut(s) 35, 36, 147
BpuMI CCSGG 2 cut(s) 35, 36
BsaJI CCNNGG 4 cut(s) 34, 146, 189, 267
Bsc4I CCNNNNNNNGG 3 cut(s) 17, 18, 34
Bse1I ACTGG 1 cut(s) 204
BseBI CCWGG 1 cut(s) 147
BseDI CCNNGG 4 cut(s) 34, 146, 189, 267
BseGI GGATG 5 cut(s) 7, 138, 142, 244, 287
BseLI CCNNNNNNNGG 3 cut(s) 17, 18, 34
BseNI ACTGG 1 cut(s) 204
BseSI GKGCMC 1 cut(s) 41
BseYI CCCAGC 1 cut(s) 11
BshFI GGCC 2 cut(s) 39, 222
BsiHKAI GWGCWC 1 cut(s) 213
BsiHKCI CYCGRG 1 cut(s) 34
BsiSI CCGG 1 cut(s) 35
BslFI GGGAC 2 cut(s) 63, 170
BslI CCNNNNNNNGG 3 cut(s) 17, 18, 34
BsmFI GGGAC 2 cut(s) 63, 170
BsmI GAATGC 1 cut(s) 157
BsnI GGCC 2 cut(s) 39, 222
BsoBI CYCGRG 1 cut(s) 34
Bsp120I GGGCCC 1 cut(s) 37
Bsp1286I GDGCHC 2 cut(s) 41, 213
Bsp143I GATC 1 cut(s) 258
Bsp19I CCATGG 2 cut(s) 189, 267
BspACI CCGC 1 cut(s) 41
BspANI GGCC 2 cut(s) 39, 222
BspLI GGNNCC 3 cut(s) 26, 39, 195
BspPI GGATC 1 cut(s) 266
BsrBI CCGCTC 1 cut(s) 43
BsrI ACTGG 1 cut(s) 204
BssECI CCNNGG 4 cut(s) 34, 146, 189, 267
BssMI GATC 1 cut(s) 258
BssSI CACGAG 3 cut(s) 118, 158, 224
BssT1I CCWWGG 2 cut(s) 189, 267
Bst2BI CACGAG 3 cut(s) 118, 158, 224
Bst2UI CCWGG 1 cut(s) 147
Bst4CI ACNGT 1 cut(s) 97
BstC8I GCNNGC 1 cut(s) 41
BstDSI CCRYGG 2 cut(s) 189, 267
BstF5I GGATG 5 cut(s) 7, 138, 142, 244, 287
BstHHI GCGC 1 cut(s) 165
BstKTI GATC 1 cut(s) 261
BstMBI GATC 1 cut(s) 258
BstNI CCWGG 1 cut(s) 147
BstSCI CCNGG 3 cut(s) 33, 34, 145
BstSLI GKGCMC 1 cut(s) 41
BsuRI GGCC 2 cut(s) 39, 222
BtgI CCRYGG 2 cut(s) 189, 267
BtgZI GCGATG 1 cut(s) 288
BtsCI GGATG 5 cut(s) 7, 138, 142, 244, 287
BtsIMutI CAGTG 1 cut(s) 211
Cac8I GCNNGC 1 cut(s) 41
CfoI GCGC 1 cut(s) 165
Cfr13I GGNCC 2 cut(s) 37, 38
Cfr9I CCCGGG 1 cut(s) 34
CviAII CATG 3 cut(s) 86, 190, 268
CviJI RGCY 3 cut(s) 39, 211, 222
CviKI_1 RGCY 3 cut(s) 39, 211, 222
DpnI GATC 1 cut(s) 260
DpnII GATC 1 cut(s) 258
Ecl136II GAGCTC 1 cut(s) 211
Eco130I CCWWGG 2 cut(s) 189, 267
Eco147I AGGCCT 1 cut(s) 222
Eco24I GRGCYC 2 cut(s) 41, 213
Eco53kI GAGCTC 1 cut(s) 211
Eco88I CYCGRG 1 cut(s) 34
EcoICRI GAGCTC 1 cut(s) 211
EcoRII CCWGG 1 cut(s) 145
EcoT14I CCWWGG 2 cut(s) 189, 267
EcoT38I GRGCYC 2 cut(s) 41, 213
ErhI CCWWGG 2 cut(s) 189, 267
FaeI CATG 3 cut(s) 89, 193, 271
FaiI YATR 7 cut(s) 54, 87, 191, 248, 252, 254, 269
FaqI GGGAC 2 cut(s) 63, 170
FatI CATG 3 cut(s) 85, 189, 267
FauI CCCGC 1 cut(s) 48
FblI GTMKAC 1 cut(s) 68
FokI GGATG 4 cut(s) 125, 129, 251, 294
FriOI GRGCYC 2 cut(s) 41, 213
FspBI CTAG 1 cut(s) 230
GlaI GCGC 1 cut(s) 164
GsaI CCCAGC 1 cut(s) 15
HaeIII GGCC 2 cut(s) 39, 222
HapII CCGG 1 cut(s) 35
HhaI GCGC 1 cut(s) 165
Hin1II CATG 3 cut(s) 89, 193, 271
Hin6I GCGC 1 cut(s) 163
HinP1I GCGC 1 cut(s) 163
HinfI GANTC 2 cut(s) 76, 183
HpaII CCGG 1 cut(s) 35
Hpy166II GTNNAC 1 cut(s) 69
Hpy188I TCNGA 1 cut(s) 182
Hpy188III TCNNGA 1 cut(s) 129
Hpy8I GTNNAC 1 cut(s) 69
HpyCH4III ACNGT 1 cut(s) 97
Hsp92II CATG 3 cut(s) 89, 193, 271
HspAI GCGC 1 cut(s) 163
Kzo9I GATC 1 cut(s) 258
LmnI GCTCC 2 cut(s) 48, 216
LpnPI CCDG 6 cut(s) 25, 48, 92, 132, 159, 217
MaeI CTAG 1 cut(s) 230
MaeIII GTNAC 2 cut(s) 3, 284
MalI GATC 1 cut(s) 260
MbiI CCGCTC 1 cut(s) 43
MboI GATC 1 cut(s) 258
MhlI GDGCHC 2 cut(s) 41, 213
MlyI GAGTC 2 cut(s) 85, 192
MnlI CCTC 2 cut(s) 101, 233
MroXI GAANNNNTTC 1 cut(s) 29
MseI TTAA 2 cut(s) 174, 301
MslI CAYNNNNRTG 1 cut(s) 266
MspI CCGG 1 cut(s) 35
MspR9I CCNGG 3 cut(s) 35, 36, 147
Mva1269I GAATGC 1 cut(s) 157
MvaI CCWGG 1 cut(s) 147
NciI CCSGG 2 cut(s) 35, 36
NcoI CCATGG 2 cut(s) 189, 267
NdeII GATC 1 cut(s) 258
NlaIII CATG 3 cut(s) 89, 193, 271
NlaIV GGNNCC 3 cut(s) 26, 39, 195
NmuCI GTSAC 2 cut(s) 3, 284
PceI AGGCCT 1 cut(s) 222
PctI GAATGC 1 cut(s) 157
PdmI GAANNNNTTC 1 cut(s) 29
PleI GAGTC 2 cut(s) 84, 191
PpsI GAGTC 2 cut(s) 84, 191
Psp124BI GAGCTC 1 cut(s) 213
Psp6I CCWGG 1 cut(s) 145
PspFI CCCAGC 1 cut(s) 11
PspGI CCWGG 1 cut(s) 145
PspN4I GGNNCC 3 cut(s) 26, 39, 195
PspOMI GGGCCC 1 cut(s) 37
PspPI GGNCC 2 cut(s) 37, 38
RseI CAYNNNNRTG 1 cut(s) 266
SacI GAGCTC 1 cut(s) 213
SaqAI TTAA 2 cut(s) 174, 301
Sau3AI GATC 1 cut(s) 258
Sau96I GGNCC 2 cut(s) 37, 38
SchI GAGTC 2 cut(s) 85, 192
ScrFI CCNGG 3 cut(s) 35, 36, 147
SduI GDGCHC 2 cut(s) 41, 213
SetI ASST 2 cut(s) 213, 235
SmaI CCCGGG 1 cut(s) 36
SmiMI CAYNNNNRTG 1 cut(s) 266
SseBI AGGCCT 1 cut(s) 222
SsiI CCGC 1 cut(s) 41
SspMI CTAG 1 cut(s) 230
SstI GAGCTC 1 cut(s) 213
StuI AGGCCT 1 cut(s) 222
StyD4I CCNGG 3 cut(s) 33, 34, 145
StyI CCWWGG 2 cut(s) 189, 267
TaaI ACNGT 1 cut(s) 97
Tru1I TTAA 2 cut(s) 174, 301
Tru9I TTAA 2 cut(s) 174, 301
TscAI CASTG 1 cut(s) 211
TseFI GTSAC 2 cut(s) 3, 284
Tsp45I GTSAC 2 cut(s) 3, 284
TspMI CCCGGG 1 cut(s) 34
TspRI CASTG 1 cut(s) 211
XcmI CCANNNNNNNNNTGG 1 cut(s) 274
XmaI CCCGGG 1 cut(s) 34
XmiI GTMKAC 1 cut(s) 68
XmnI GAANNNNTTC 1 cut(s) 29
XspI CTAG 1 cut(s) 230
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.