pycom01g02750

LRR receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
Physical Location & Seq
Forward (+)
2256678 .. 2258169
1492 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g02750.4

Sequence Viewer

Length: 1095 bp
ATGGAAATCTCCTATTATATCCAACTTATTCTCTACATTCATATAATTCACCCTCACAACCCAATTCAATATGTAAATTTATCTTTACAACCATTCAAAAAAATTAAAAACCACATAAAATTCATTACACTTTTAAACTTAGCGAGATTAAAAGACTACTTTGAGTTCCTATTTCTTCTGATTTCTTGGTTCATAGCGCACAACAGTGGCGACAACTCGTTTCCCCTCGTTGACAACTTTGTTGCTACTGGTCCAATACACTTGTATATACATACCTATCTTAAAAATAGGTTCAGTAGCAGGACAAGCCAACTTCAGCACAGACCAAGCTACTCTTCAAATCCGCACACAGGAAATTTGTCACTTCCTGTTGAGCTGGAATTCAGAAACAACAATTTCGGTGGTACCTTGCCATTGGAATTGTCTCATCTACACAGGTTGAAGTTGATTAGCTTTATGGCAATAAAGATCGGGGTAATGGTTGTTTGTGCAACTAATGCTCTAAAAGGTGATATTCATGTTGTTGTCTTGAACATGTCCTCTTTGATAGTTTTGGCTCTAACCCTAAACAATTTAAGTGGTAGTTTACCAGACCATATATGCCAACATCTTCCAATCATTCAGGGGTTGCATTTGCCGCACAACCAGTTTGATGGAGGAAATTTTAGTTTTATTGTTAATTTTATCTTGTACTTAATGTTTAAGTTGGGTGTAAAAAGAGATTATATGGATTCAAATAAAATTTGTCACATCCTAGCTCGGGCCCCCACCACATTACGGGCTCGACTCCACTGTAGCACAATATTGTCCGCTTTAGGCCCCGACCACGTCCTCACGGTTTTGTTTCTGGGAACTCACGAGCAACTTCCTAGTGAGTCACCTATCCTAGGATTGCTCTTGCTTAAACTCAGATGGGAATATACATATAAAGCTTACAGGATCCACTCCCCAGGGCGATGTGGGATGTTACAATCCATCCCTCTTAGGGGCCCAACGTCCTTGTCGGCACACCTCTGGCTAGGGATTGGCTCTGATACCAAATTGTCACATCCCGGCCCAGGTCCCCACCACATTCCGGGCTTGACTCCACCGTAG

Protein Analysis

365

Amino Acids

41.07

Weight (kDa)

9.46

Isoelectric Point (pI)

40.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 404
AccB1I GGYRCC 1 cut(s) 404
AciI CCGC 3 cut(s) 344, 638, 810
AclWI GGATC 2 cut(s) 934, 947
AcsI RAATTY 6 cut(s) 76, 119, 355, 380, 661, 741
AcuI CTGAAG 1 cut(s) 299
AfaI GTAC 2 cut(s) 406, 692
AfiI CCNNNNNNNGG 8 cut(s) 350, 760, 777, 887, 985, 986, 1058, 1075
AflIII ACRYGT 1 cut(s) 534
AgsI TTSAA 6 cut(s) 68, 97, 339, 442, 532, 735
AjiI CACGTC 1 cut(s) 829
AjnI CCWGG 2 cut(s) 949, 1057
AjuI GAANNNNNNNTTGG 2 cut(s) 319, 351
AleI CACNNNNGTG 1 cut(s) 204
AluBI AGCT 5 cut(s) 330, 376, 453, 758, 932
AluI AGCT 5 cut(s) 330, 376, 453, 758, 932
Alw26I GTCTC 1 cut(s) 429
AlwI GGATC 2 cut(s) 934, 947
Ama87I CYCGRG 1 cut(s) 759
AoxI GGCC 4 cut(s) 762, 817, 988, 1054
ApaI GGGCCC 2 cut(s) 766, 992
ApoI RAATTY 6 cut(s) 76, 119, 355, 380, 661, 741
Asp718I GGTACC 1 cut(s) 404
AspA2I CCTAGG 1 cut(s) 886
AspLEI GCGC 1 cut(s) 199
AspS9I GGNCC 8 cut(s) 251, 762, 763, 818, 988, 989, 1055, 1061
AsuC2I CCSGG 2 cut(s) 1053, 1077
AsuHPI GGTGA 3 cut(s) 41, 521, 870
AvaI CYCGRG 1 cut(s) 759
AvaII GGWCC 2 cut(s) 251, 1061
AvrII CCTAGG 1 cut(s) 886
BaeGI GKGCMC 2 cut(s) 766, 992
BamHI GGATCC 1 cut(s) 939
BanI GGYRCC 1 cut(s) 404
BanII GRGCYC 3 cut(s) 766, 784, 992
BauI CACGAG 1 cut(s) 857
BccI CCATC 3 cut(s) 647, 906, 983
BciT130I CCWGG 2 cut(s) 951, 1059
BcnI CCSGG 2 cut(s) 1053, 1077
BcoDI GTCTC 1 cut(s) 429
BfaI CTAG 4 cut(s) 755, 870, 887, 1019
BfmI CTRYAG 1 cut(s) 793
BisI GCNGC 1 cut(s) 638
BlnI CCTAGG 1 cut(s) 886
BlsI GCNGC 1 cut(s) 639
Bme1390I CCNGG 4 cut(s) 951, 1053, 1059, 1077
Bme18I GGWCC 2 cut(s) 251, 1061
BmeT110I CYCGRG 1 cut(s) 759
BmgBI CACGTC 1 cut(s) 829
BmgT120I GGNCC 8 cut(s) 251, 762, 763, 818, 988, 989, 1055, 1061
BmiI GGNNCC 8 cut(s) 406, 764, 765, 820, 941, 989, 990, 1063
BmrFI CCNGG 4 cut(s) 951, 1053, 1059, 1077
BpuMI CCSGG 2 cut(s) 1053, 1077
BsaJI CCNNGG 4 cut(s) 886, 949, 950, 1057
Bsc4I CCNNNNNNNGG 8 cut(s) 350, 760, 777, 887, 985, 986, 1058, 1075
Bse1I ACTGG 2 cut(s) 253, 646
BseBI CCWGG 2 cut(s) 951, 1059
BseDI CCNNGG 4 cut(s) 886, 949, 950, 1057
BseGI GGATG 4 cut(s) 750, 969, 975, 1048
BseLI CCNNNNNNNGG 8 cut(s) 350, 760, 777, 887, 985, 986, 1058, 1075
BseMII CTCAG 1 cut(s) 922
BseNI ACTGG 2 cut(s) 253, 646
BseSI GKGCMC 2 cut(s) 766, 992
BshFI GGCC 4 cut(s) 764, 819, 990, 1056
BshNI GGYRCC 1 cut(s) 404
BsiHKCI CYCGRG 1 cut(s) 759
BsiSI CCGG 2 cut(s) 1053, 1076
BslFI GGGAC 1 cut(s) 1047
BslI CCNNNNNNNGG 8 cut(s) 350, 760, 777, 887, 985, 986, 1058, 1075
BsmAI GTCTC 1 cut(s) 429
BsmFI GGGAC 1 cut(s) 1047
BsnI GGCC 4 cut(s) 764, 819, 990, 1056
BsoBI CYCGRG 1 cut(s) 759
Bsp120I GGGCCC 2 cut(s) 762, 988
Bsp1286I GDGCHC 3 cut(s) 766, 784, 992
Bsp143I GATC 2 cut(s) 468, 939
BspACI CCGC 3 cut(s) 344, 638, 810
BspANI GGCC 4 cut(s) 764, 819, 990, 1056
BspCNI CTCAG 1 cut(s) 921
BspLI GGNNCC 8 cut(s) 406, 764, 765, 820, 941, 989, 990, 1063
BspPI GGATC 2 cut(s) 934, 947
BspT107I GGYRCC 1 cut(s) 404
BsrI ACTGG 2 cut(s) 253, 646
BssECI CCNNGG 4 cut(s) 886, 949, 950, 1057
BssMI GATC 2 cut(s) 468, 939
BssSI CACGAG 1 cut(s) 857
BssT1I CCWWGG 1 cut(s) 886
Bst2BI CACGAG 1 cut(s) 857
Bst2UI CCWGG 2 cut(s) 951, 1059
Bst4CI ACNGT 4 cut(s) 206, 794, 838, 1092
Bst6I CTCTTC 1 cut(s) 340
BstAPI GCANNNNNTGC 1 cut(s) 497
BstDEI CTNAG 3 cut(s) 139, 908, 983
BstENI CCTNNNNNAGG 1 cut(s) 885
BstF5I GGATG 4 cut(s) 750, 969, 975, 1048
BstHHI GCGC 1 cut(s) 199
BstKTI GATC 2 cut(s) 471, 942
BstMAI GTCTC 1 cut(s) 429
BstMBI GATC 2 cut(s) 468, 939
BstMWI GCNNNNNNNGC 3 cut(s) 306, 497, 637
BstNI CCWGG 2 cut(s) 951, 1059
BstNSI RCATGY 1 cut(s) 538
BstSCI CCNGG 4 cut(s) 949, 1051, 1057, 1075
BstSFI CTRYAG 1 cut(s) 793
BstSLI GKGCMC 2 cut(s) 766, 992
BstX2I RGATCY 1 cut(s) 939
BstXI CCANNNNNNTGG 1 cut(s) 653
BstYI RGATCY 1 cut(s) 939
BsuRI GGCC 4 cut(s) 764, 819, 990, 1056
BtgZI GCGATG 1 cut(s) 970
BtrI CACGTC 1 cut(s) 829
BtsCI GGATG 4 cut(s) 750, 969, 975, 1048
BtsIMutI CAGTG 2 cut(s) 211, 790
CfoI GCGC 1 cut(s) 199
Cfr13I GGNCC 8 cut(s) 251, 762, 763, 818, 988, 989, 1055, 1061
Csp6I GTAC 2 cut(s) 405, 691
CspCI CAANNNNNGTGG 4 cut(s) 382, 417, 559, 594
CviAII CATG 2 cut(s) 518, 535
CviQI GTAC 2 cut(s) 405, 691
DdeI CTNAG 3 cut(s) 139, 908, 983
DpnI GATC 2 cut(s) 470, 941
DpnII GATC 2 cut(s) 468, 939
DraI TTTAAA 1 cut(s) 135
Eam1104I CTCTTC 1 cut(s) 340
EarI CTCTTC 1 cut(s) 340
Eco130I CCWWGG 1 cut(s) 886
Eco24I GRGCYC 3 cut(s) 766, 784, 992
Eco47I GGWCC 2 cut(s) 251, 1061
Eco57I CTGAAG 1 cut(s) 299
Eco88I CYCGRG 1 cut(s) 759
EcoNI CCTNNNNNAGG 1 cut(s) 885
EcoO109I RGGNCCY 4 cut(s) 763, 818, 988, 1061
EcoRI GAATTC 1 cut(s) 380
EcoRII CCWGG 2 cut(s) 949, 1057
EcoT14I CCWWGG 1 cut(s) 886
EcoT38I GRGCYC 3 cut(s) 766, 784, 992
ErhI CCWWGG 1 cut(s) 886
FaeI CATG 2 cut(s) 521, 538
FalI AAGNNNNNCTT 2 cut(s) 319, 351
FaqI GGGAC 1 cut(s) 1047
FatI CATG 2 cut(s) 517, 534
Fnu4HI GCNGC 1 cut(s) 638
FokI GGATG 4 cut(s) 737, 962, 976, 1035
FriOI GRGCYC 3 cut(s) 766, 784, 992
Fsp4HI GCNGC 1 cut(s) 638
FspBI CTAG 4 cut(s) 755, 870, 887, 1019
GlaI GCGC 1 cut(s) 198
GluI GCNGC 1 cut(s) 638
HaeIII GGCC 4 cut(s) 764, 819, 990, 1056
HapII CCGG 2 cut(s) 1053, 1076
HhaI GCGC 1 cut(s) 199
Hin1II CATG 2 cut(s) 521, 538
Hin6I GCGC 1 cut(s) 197
HinP1I GCGC 1 cut(s) 197
HincII GTYRAC 1 cut(s) 232
HindII GTYRAC 1 cut(s) 232
HindIII AAGCTT 1 cut(s) 930
HinfI GANTC 4 cut(s) 731, 786, 875, 1084
HpaII CCGG 2 cut(s) 1053, 1076
HphI GGTGA 3 cut(s) 41, 521, 870
Hpy166II GTNNAC 2 cut(s) 232, 587
Hpy188I TCNGA 4 cut(s) 180, 386, 911, 1033
Hpy188III TCNNGA 2 cut(s) 529, 857
Hpy8I GTNNAC 2 cut(s) 232, 587
HpyCH4III ACNGT 4 cut(s) 206, 794, 838, 1092
HpyCH4IV ACGT 2 cut(s) 828, 995
HpyCH4V TGCA 2 cut(s) 491, 631
HpyF10VI GCNNNNNNNGC 3 cut(s) 306, 497, 637
HpyF3I CTNAG 3 cut(s) 139, 908, 983
HpySE526I ACGT 2 cut(s) 828, 995
Hsp92II CATG 2 cut(s) 521, 538
HspAI GCGC 1 cut(s) 197
KpnI GGTACC 1 cut(s) 408
Kzo9I GATC 2 cut(s) 468, 939
MaeI CTAG 4 cut(s) 755, 870, 887, 1019
MaeII ACGT 2 cut(s) 828, 995
MaeIII GTNAC 5 cut(s) 360, 746, 876, 966, 1044
MalI GATC 2 cut(s) 470, 941
MboI GATC 2 cut(s) 468, 939
MboII GAAGA 3 cut(s) 167, 327, 602
MflI RGATCY 1 cut(s) 939
MhlI GDGCHC 3 cut(s) 766, 784, 992
MlyI GAGTC 3 cut(s) 780, 884, 1078
MmeI TCCRAC 1 cut(s) 46
MnlI CCTC 7 cut(s) 63, 236, 550, 650, 842, 990, 1022
MseI TTAA 9 cut(s) 105, 134, 149, 282, 575, 678, 695, 702, 903
MslI CAYNNNNRTG 1 cut(s) 204
MspI CCGG 2 cut(s) 1053, 1076
MspR9I CCNGG 4 cut(s) 951, 1053, 1059, 1077
MvaI CCWGG 2 cut(s) 951, 1059
MwoI GCNNNNNNNGC 3 cut(s) 306, 497, 637
NciI CCSGG 2 cut(s) 1053, 1077
NdeII GATC 2 cut(s) 468, 939
NlaIII CATG 2 cut(s) 521, 538
NlaIV GGNNCC 8 cut(s) 406, 764, 765, 820, 941, 989, 990, 1063
NmuCI GTSAC 4 cut(s) 360, 746, 876, 1044
NspI RCATGY 1 cut(s) 538
OliI CACNNNNGTG 1 cut(s) 204
PasI CCCWGGG 1 cut(s) 950
PciI ACATGT 1 cut(s) 534
PfeI GAWTC 1 cut(s) 731
PflFI GACNNNGTC 1 cut(s) 827
PkrI GCNGC 1 cut(s) 639
PleI GAGTC 3 cut(s) 780, 883, 1078
PpsI GAGTC 3 cut(s) 780, 883, 1078
PpuMI RGGWCCY 1 cut(s) 1061
PscI ACATGT 1 cut(s) 534
Psp5II RGGWCCY 1 cut(s) 1061
Psp6I CCWGG 2 cut(s) 949, 1057
PspGI CCWGG 2 cut(s) 949, 1057
PspN4I GGNNCC 8 cut(s) 406, 764, 765, 820, 941, 989, 990, 1063
PspOMI GGGCCC 2 cut(s) 762, 988
PspPI GGNCC 8 cut(s) 251, 762, 763, 818, 988, 989, 1055, 1061
PspPPI RGGWCCY 1 cut(s) 1061
PsuI RGATCY 1 cut(s) 939
PsyI GACNNNGTC 1 cut(s) 827
RsaI GTAC 2 cut(s) 406, 692
RsaNI GTAC 2 cut(s) 405, 691
RseI CAYNNNNRTG 1 cut(s) 204
SaqAI TTAA 9 cut(s) 105, 134, 149, 282, 575, 678, 695, 702, 903
SatI GCNGC 1 cut(s) 638
Sau3AI GATC 2 cut(s) 468, 939
Sau96I GGNCC 8 cut(s) 251, 762, 763, 818, 988, 989, 1055, 1061
SchI GAGTC 3 cut(s) 780, 884, 1078
ScrFI CCNGG 4 cut(s) 951, 1053, 1059, 1077
SduI GDGCHC 3 cut(s) 766, 784, 992
SfcI CTRYAG 1 cut(s) 793
SinI GGWCC 2 cut(s) 251, 1061
SmiMI CAYNNNNRTG 1 cut(s) 204
SsiI CCGC 3 cut(s) 344, 638, 810
SspI AATATT 1 cut(s) 804
SspMI CTAG 4 cut(s) 755, 870, 887, 1019
StyD4I CCNGG 4 cut(s) 949, 1051, 1057, 1075
StyI CCWWGG 1 cut(s) 886
TaaI ACNGT 4 cut(s) 206, 794, 838, 1092
TaiI ACGT 2 cut(s) 831, 998
TaqI TCGA 1 cut(s) 784
TatI WGTACW 1 cut(s) 690
TauI GCSGC 1 cut(s) 640
TfiI GAWTC 1 cut(s) 731
Tru1I TTAA 9 cut(s) 105, 134, 149, 282, 575, 678, 695, 702, 903
Tru9I TTAA 9 cut(s) 105, 134, 149, 282, 575, 678, 695, 702, 903
TscAI CASTG 2 cut(s) 211, 797
TseFI GTSAC 4 cut(s) 360, 746, 876, 1044
Tsp45I GTSAC 4 cut(s) 360, 746, 876, 1044
TspDTI ATGAA 4 cut(s) 29, 112, 181, 506
TspRI CASTG 2 cut(s) 211, 797
Tth111I GACNNNGTC 1 cut(s) 827
VpaK11BI GGWCC 2 cut(s) 251, 1061
XagI CCTNNNNNAGG 1 cut(s) 885
XapI RAATTY 6 cut(s) 76, 119, 355, 380, 661, 741
XceI RCATGY 1 cut(s) 538
XmaJI CCTAGG 1 cut(s) 886
XspI CTAG 4 cut(s) 755, 870, 887, 1019
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.