pycom01g02480

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
OG0000158
Physical Location & Seq
Forward (+)
1997562 .. 1998933
1372 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g02480.4

Sequence Viewer

Length: 1002 bp
ATGTTCATGGCTTTGAATTCACCTCTAGCTAAAACGAAATTAGTTCCTCATAATACACCTAGAAATGCTCCAGTAATCCAAAGGCCTTGGATGGTAGGCATGGCTCTAAGCTTCTTCTTCTCCTTCCTTGCAAAGTTGCGGCACACTTTATATTTTATCTCTGAAATTCTCTCTAAAGCTCTCCCTTTATGCGATAGATGTGTGGTAAGGATTACACGACACAAACCAAGAAGGAAAAAGACTAGGGTGATGCGGCAGATTCCTAAAGGAAAAGGGTTACCTGGGGTCCACCATATCCCAGGCCCGCTCCACCACCGTAACACGATATTGTTCGCTTTGGGCTCCAACCACGCCCTCACGGTTTTGTTTCTGAGAACTCACGAGAGAACTTCCCAGTGGGTCACCCATCATGGGAGTGCTCTCGCACGCTACTCACTTAACTTCGGAGTTCCCATGGAACCCGAAGCCAATACATATAACGATCACTCCCCTGGGCGATGTGGGATCTTACAATCCACCCCCTTAAGGACCCGACGTCCTCTGTCACATCCCAGTGCGGGCCCCCACCACAACCCAGGCCCGCTTCACCACCGTAACACGATATTGTCCGCTTTAGGCCCCGACCATACCTTCACGATTTTGTTTCTAGGAACTCGCTCGAGAACTTCCCAGTGGGTCACCCATCATGGGAGTGCTCTCATGCACTACTCACTTAAATTCGGAGTTCCCATGGAACCCGAAGCCAGTGAGCTCCCAAAAGGCTTCGTGCTAGGTAAGAATGAGAATATACATATAAGGATCACTCCCCTGGTTAATGTGAAATTGATTCCCCCTTGCAATAAGGTTTTGGATAATTTTCTTAAACTCTTTAGCACATTCCTAGCCTCTTTTGATCTTCAAAAACGTCCATCCACCTTGCTCCATGCATGTGCTATCCATTCCAAGCCCAAAACTGCTCTAAAATGCTCTAAATTGCCTTTTCTTGCCACTTTTACCATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

334

Amino Acids

37.47

Weight (kDa)

10.91

Isoelectric Point (pI)

47.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 538
AccBSI CCGCTC 1 cut(s) 307
AciI CCGC 6 cut(s) 139, 253, 305, 557, 581, 609
AclWI GGATC 2 cut(s) 512, 806
AcsI RAATTY 3 cut(s) 16, 165, 716
AcyI GRCGYC 1 cut(s) 535
AfiI CCNNNNNNNGG 4 cut(s) 411, 525, 557, 687
AflII CTTAAG 1 cut(s) 523
AgsI TTSAA 2 cut(s) 16, 899
AhdI GACNNNNNGTC 1 cut(s) 534
AjnI CCWGG 5 cut(s) 280, 298, 490, 574, 807
AluBI AGCT 4 cut(s) 29, 111, 179, 751
AluI AGCT 4 cut(s) 29, 111, 179, 751
Alw21I GWGCWC 3 cut(s) 421, 697, 753
AlwI GGATC 2 cut(s) 512, 806
Ama87I CYCGRG 1 cut(s) 658
AoxI GGCC 5 cut(s) 83, 301, 559, 577, 616
ApaI GGGCCC 1 cut(s) 563
ApoI RAATTY 3 cut(s) 16, 165, 716
AspS9I GGNCC 7 cut(s) 286, 302, 528, 559, 560, 578, 617
AsuHPI GGTGA 5 cut(s) 12, 259, 394, 578, 670
AvaI CYCGRG 1 cut(s) 658
AvaII GGWCC 2 cut(s) 286, 528
BaeGI GKGCMC 1 cut(s) 563
BanII GRGCYC 3 cut(s) 344, 563, 753
BauI CACGAG 1 cut(s) 380
Bbv12I GWGCWC 3 cut(s) 421, 697, 753
BccI CCATC 4 cut(s) 85, 414, 690, 916
BciT130I CCWGG 5 cut(s) 282, 300, 492, 576, 809
BfaI CTAG 6 cut(s) 26, 60, 243, 647, 770, 881
BfrI CTTAAG 1 cut(s) 523
BisI GCNGC 2 cut(s) 140, 254
BlsI GCNGC 2 cut(s) 141, 255
Bme1390I CCNGG 5 cut(s) 282, 300, 492, 576, 809
Bme18I GGWCC 2 cut(s) 286, 528
BmeRI GACNNNNNGTC 1 cut(s) 534
BmeT110I CYCGRG 1 cut(s) 658
BmgT120I GGNCC 7 cut(s) 286, 302, 528, 559, 560, 578, 617
BmiI GGNNCC 8 cut(s) 287, 343, 459, 530, 561, 562, 619, 735
BmrFI CCNGG 5 cut(s) 282, 300, 492, 576, 809
BmrI ACTGGG 3 cut(s) 388, 546, 664
BmsI GCATC 1 cut(s) 240
BmuI ACTGGG 3 cut(s) 388, 546, 664
BpmI CTGGAG 1 cut(s) 54
BsaHI GRCGYC 1 cut(s) 535
BsaJI CCNNGG 9 cut(s) 86, 281, 298, 453, 490, 491, 574, 729, 807
BsaXI ACNNNNNCTCC 2 cut(s) 470, 500
Bsc4I CCNNNNNNNGG 4 cut(s) 411, 525, 557, 687
Bse1I ACTGG 5 cut(s) 71, 394, 552, 670, 744
BseBI CCWGG 5 cut(s) 282, 300, 492, 576, 809
BseDI CCNNGG 9 cut(s) 86, 281, 298, 453, 490, 491, 574, 729, 807
BseGI GGATG 3 cut(s) 96, 547, 908
BseLI CCNNNNNNNGG 4 cut(s) 411, 525, 557, 687
BseMII CTCAG 1 cut(s) 362
BseNI ACTGG 5 cut(s) 71, 394, 552, 670, 744
BseSI GKGCMC 1 cut(s) 563
BshFI GGCC 5 cut(s) 85, 303, 561, 579, 618
BsiHKAI GWGCWC 3 cut(s) 421, 697, 753
BsiHKCI CYCGRG 1 cut(s) 658
BslI CCNNNNNNNGG 4 cut(s) 411, 525, 557, 687
BsnI GGCC 5 cut(s) 85, 303, 561, 579, 618
BsoBI CYCGRG 1 cut(s) 658
Bsp120I GGGCCC 1 cut(s) 559
Bsp1286I GDGCHC 5 cut(s) 344, 421, 563, 697, 753
Bsp143I GATC 4 cut(s) 481, 504, 798, 892
Bsp19I CCATGG 2 cut(s) 453, 729
BspACI CCGC 6 cut(s) 139, 253, 305, 557, 581, 609
BspANI GGCC 5 cut(s) 85, 303, 561, 579, 618
BspCNI CTCAG 1 cut(s) 363
BspLI GGNNCC 8 cut(s) 287, 343, 459, 530, 561, 562, 619, 735
BspPI GGATC 2 cut(s) 512, 806
BspTI CTTAAG 1 cut(s) 523
BsrBI CCGCTC 1 cut(s) 307
BsrI ACTGG 5 cut(s) 71, 394, 552, 670, 744
BssECI CCNNGG 9 cut(s) 86, 281, 298, 453, 490, 491, 574, 729, 807
BssMI GATC 4 cut(s) 481, 504, 798, 892
BssNI GRCGYC 1 cut(s) 535
BssSI CACGAG 1 cut(s) 380
BssT1I CCWWGG 3 cut(s) 86, 453, 729
Bst2BI CACGAG 1 cut(s) 380
Bst2UI CCWGG 5 cut(s) 282, 300, 492, 576, 809
Bst4CI ACNGT 3 cut(s) 317, 361, 593
BstACI GRCGYC 1 cut(s) 535
BstAFI CTTAAG 1 cut(s) 523
BstC8I GCNNGC 4 cut(s) 305, 427, 559, 581
BstDEI CTNAG 2 cut(s) 107, 371
BstDSI CCRYGG 2 cut(s) 453, 729
BstEII GGTNACC 3 cut(s) 276, 400, 676
BstF5I GGATG 3 cut(s) 96, 547, 908
BstKTI GATC 4 cut(s) 484, 507, 801, 895
BstMBI GATC 4 cut(s) 481, 504, 798, 892
BstNI CCWGG 5 cut(s) 282, 300, 492, 576, 809
BstNSI RCATGY 1 cut(s) 930
BstPI GGTNACC 3 cut(s) 276, 400, 676
BstSCI CCNGG 5 cut(s) 280, 298, 490, 574, 807
BstSLI GKGCMC 1 cut(s) 563
BstX2I RGATCY 1 cut(s) 504
BstYI RGATCY 1 cut(s) 504
BsuRI GGCC 5 cut(s) 85, 303, 561, 579, 618
BtgI CCRYGG 2 cut(s) 453, 729
BtgZI GCGATG 1 cut(s) 511
BtsCI GGATG 3 cut(s) 96, 547, 908
BtsIMutI CAGTG 4 cut(s) 401, 559, 677, 751
Cac8I GCNNGC 4 cut(s) 305, 427, 559, 581
Cfr13I GGNCC 7 cut(s) 286, 302, 528, 559, 560, 578, 617
CviAII CATG 9 cut(s) 7, 100, 410, 454, 686, 700, 730, 923, 927
DdeI CTNAG 2 cut(s) 107, 371
DpnI GATC 4 cut(s) 483, 506, 800, 894
DpnII GATC 4 cut(s) 481, 504, 798, 892
DriI GACNNNNNGTC 1 cut(s) 534
Eam1105I GACNNNNNGTC 1 cut(s) 534
Ecl136II GAGCTC 1 cut(s) 751
Eco130I CCWWGG 3 cut(s) 86, 453, 729
Eco147I AGGCCT 1 cut(s) 85
Eco24I GRGCYC 3 cut(s) 344, 563, 753
Eco47I GGWCC 2 cut(s) 286, 528
Eco53kI GAGCTC 1 cut(s) 751
Eco88I CYCGRG 1 cut(s) 658
Eco91I GGTNACC 3 cut(s) 276, 400, 676
EcoICRI GAGCTC 1 cut(s) 751
EcoO109I RGGNCCY 3 cut(s) 528, 560, 617
EcoO65I GGTNACC 3 cut(s) 276, 400, 676
EcoRI GAATTC 1 cut(s) 16
EcoRII CCWGG 5 cut(s) 280, 298, 490, 574, 807
EcoT14I CCWWGG 3 cut(s) 86, 453, 729
EcoT22I ATGCAT 1 cut(s) 928
EcoT38I GRGCYC 3 cut(s) 344, 563, 753
ErhI CCWWGG 3 cut(s) 86, 453, 729
FaeI CATG 9 cut(s) 10, 103, 413, 457, 689, 703, 733, 926, 930
FatI CATG 9 cut(s) 6, 99, 409, 453, 685, 699, 729, 922, 926
FauI CCCGC 3 cut(s) 312, 550, 588
Fnu4HI GCNGC 2 cut(s) 140, 254
FokI GGATG 3 cut(s) 103, 534, 895
FriOI GRGCYC 3 cut(s) 344, 563, 753
Fsp4HI GCNGC 2 cut(s) 140, 254
FspBI CTAG 6 cut(s) 26, 60, 243, 647, 770, 881
GluI GCNGC 2 cut(s) 140, 254
GsuI CTGGAG 1 cut(s) 54
HaeIII GGCC 5 cut(s) 85, 303, 561, 579, 618
Hin1I GRCGYC 1 cut(s) 535
Hin1II CATG 9 cut(s) 10, 103, 413, 457, 689, 703, 733, 926, 930
HindIII AAGCTT 1 cut(s) 109
HinfI GANTC 2 cut(s) 259, 826
HphI GGTGA 5 cut(s) 12, 259, 394, 578, 670
Hpy166II GTNNAC 1 cut(s) 289
Hpy188I TCNGA 4 cut(s) 163, 372, 446, 722
Hpy188III TCNNGA 3 cut(s) 380, 634, 660
Hpy8I GTNNAC 1 cut(s) 289
Hpy99I CGWCG 1 cut(s) 537
HpyAV CCTTC 3 cut(s) 133, 225, 640
HpyCH4III ACNGT 3 cut(s) 317, 361, 593
HpyCH4IV ACGT 2 cut(s) 535, 904
HpyCH4V TGCA 4 cut(s) 131, 703, 837, 926
HpyF3I CTNAG 2 cut(s) 107, 371
HpySE526I ACGT 2 cut(s) 535, 904
Hsp92I GRCGYC 1 cut(s) 535
Hsp92II CATG 9 cut(s) 10, 103, 413, 457, 689, 703, 733, 926, 930
Kzo9I GATC 4 cut(s) 481, 504, 798, 892
LmnI GCTCC 5 cut(s) 73, 312, 347, 756, 924
LweI GCATC 1 cut(s) 240
MaeI CTAG 6 cut(s) 26, 60, 243, 647, 770, 881
MaeII ACGT 2 cut(s) 535, 904
MaeIII GTNAC 6 cut(s) 276, 317, 400, 543, 593, 676
MalI GATC 4 cut(s) 483, 506, 800, 894
MbiI CCGCTC 1 cut(s) 307
MboI GATC 4 cut(s) 481, 504, 798, 892
MboII GAAGA 3 cut(s) 106, 109, 887
MflI RGATCY 1 cut(s) 504
MhlI GDGCHC 5 cut(s) 344, 421, 563, 697, 753
MluCI AATT 7 cut(s) 16, 38, 165, 716, 821, 853, 971
MmeI TCCRAC 1 cut(s) 369
MnlI CCTC 5 cut(s) 33, 57, 365, 549, 895
Mph1103I ATGCAT 1 cut(s) 928
MseI TTAA 5 cut(s) 438, 524, 714, 813, 861
MslI CAYNNNNRTG 4 cut(s) 414, 552, 690, 927
MspCI CTTAAG 1 cut(s) 523
MspR9I CCNGG 5 cut(s) 282, 300, 492, 576, 809
MvaI CCWGG 5 cut(s) 282, 300, 492, 576, 809
NcoI CCATGG 2 cut(s) 453, 729
NdeII GATC 4 cut(s) 481, 504, 798, 892
NlaIII CATG 9 cut(s) 10, 103, 413, 457, 689, 703, 733, 926, 930
NlaIV GGNNCC 8 cut(s) 287, 343, 459, 530, 561, 562, 619, 735
NmuCI GTSAC 3 cut(s) 400, 543, 676
NsiI ATGCAT 1 cut(s) 928
NspI RCATGY 1 cut(s) 930
PaeR7I CTCGAG 1 cut(s) 658
PasI CCCWGGG 1 cut(s) 491
PceI AGGCCT 1 cut(s) 85
PfeI GAWTC 2 cut(s) 259, 826
PkrI GCNGC 2 cut(s) 141, 255
PpuMI RGGWCCY 1 cut(s) 528
Psp124BI GAGCTC 1 cut(s) 753
Psp5II RGGWCCY 1 cut(s) 528
Psp6I CCWGG 5 cut(s) 280, 298, 490, 574, 807
PspEI GGTNACC 3 cut(s) 276, 400, 676
PspGI CCWGG 5 cut(s) 280, 298, 490, 574, 807
PspN4I GGNNCC 8 cut(s) 287, 343, 459, 530, 561, 562, 619, 735
PspOMI GGGCCC 1 cut(s) 559
PspPI GGNCC 7 cut(s) 286, 302, 528, 559, 560, 578, 617
PspPPI RGGWCCY 1 cut(s) 528
PsuI RGATCY 1 cut(s) 504
RseI CAYNNNNRTG 4 cut(s) 414, 552, 690, 927
SacI GAGCTC 1 cut(s) 753
SaqAI TTAA 5 cut(s) 438, 524, 714, 813, 861
SatI GCNGC 2 cut(s) 140, 254
Sau3AI GATC 4 cut(s) 481, 504, 798, 892
Sau96I GGNCC 7 cut(s) 286, 302, 528, 559, 560, 578, 617
ScrFI CCNGG 5 cut(s) 282, 300, 492, 576, 809
SduI GDGCHC 5 cut(s) 344, 421, 563, 697, 753
SfaNI GCATC 1 cut(s) 240
Sfr274I CTCGAG 1 cut(s) 658
SinI GGWCC 2 cut(s) 286, 528
SlaI CTCGAG 1 cut(s) 658
SmiMI CAYNNNNRTG 4 cut(s) 414, 552, 690, 927
SmlI CTYRAG 2 cut(s) 523, 658
SmoI CTYRAG 2 cut(s) 523, 658
Sse9I AATT 7 cut(s) 16, 38, 165, 716, 821, 853, 971
SseBI AGGCCT 1 cut(s) 85
SsiI CCGC 6 cut(s) 139, 253, 305, 557, 581, 609
SspMI CTAG 6 cut(s) 26, 60, 243, 647, 770, 881
SstI GAGCTC 1 cut(s) 753
StuI AGGCCT 1 cut(s) 85
StyD4I CCNGG 5 cut(s) 280, 298, 490, 574, 807
StyI CCWWGG 3 cut(s) 86, 453, 729
TaaI ACNGT 3 cut(s) 317, 361, 593
TaiI ACGT 2 cut(s) 538, 907
TaqI TCGA 1 cut(s) 659
TasI AATT 7 cut(s) 16, 38, 165, 716, 821, 853, 971
TauI GCSGC 2 cut(s) 142, 256
TfiI GAWTC 2 cut(s) 259, 826
Tru1I TTAA 5 cut(s) 438, 524, 714, 813, 861
Tru9I TTAA 5 cut(s) 438, 524, 714, 813, 861
TscAI CASTG 4 cut(s) 401, 559, 677, 751
TseFI GTSAC 3 cut(s) 400, 543, 676
Tsp45I GTSAC 3 cut(s) 400, 543, 676
TspRI CASTG 4 cut(s) 401, 559, 677, 751
Vha464I CTTAAG 1 cut(s) 523
VpaK11BI GGWCC 2 cut(s) 286, 528
XapI RAATTY 3 cut(s) 16, 165, 716
XceI RCATGY 1 cut(s) 930
XhoI CTCGAG 1 cut(s) 658
XspI CTAG 6 cut(s) 26, 60, 243, 647, 770, 881
ZraI GACGTC 1 cut(s) 536
Zsp2I ATGCAT 1 cut(s) 928
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.