pycom11g23580

leucine-rich repeat receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
Physical Location & Seq
Forward (+)
26552151 .. 26555743
3593 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom11g23580.6

Sequence Viewer

Length: 1131 bp
ATGGAGCTCTCTTCCACTTCTGAACATATCCCTTGTTGGAAATCGTTTGACAGGTTCTATCCCCAAAGAGCTCGGAAAAATCACCACTCTGCAGAGTTTAGGGACATCGGTATGAATAATTTCTCTGGACCTCTCCCTCGGGAGCTTGGATCTTGGGCCAACATAGAAAGATTCCTGCTTTCCTCAAACAACTTTAGCGGGGAGTTGCCAAAAACATTTGCAAAGCTTACCAAAATAAAGGACTTTCGGGTTAGTGACAGTCACTTTTCTGGGCAGATACCTGATTTTATTGGGAACTGGACAAATCTTGAAAAACTATTGATTCAGGCTAGCGGTTTGACAGGGCCAATTCCTTCTGGCATTTCTCTTTTGACAAACTTAACTGACTTGAGAATCACTGACTTGAGTGGACCTGAATCACCCATTCCAAAGCTCGATAAGATGAAAAACATGAAGACACTGATGTTGAGAAGTTGCAACCTTACTGGACAGTTACCTCCATTTCTTGAGAAAATGAAAAAATTGAAAACTTTAGACCTCAGCTTTAACAAGCTGACCGGAGATATTCCAGACAGCTTTTCTAGTCTAGCAAAAGTGGATTATATATTCTTAACTGGAAACTTGCTGACTGGACGTGTACCTACTTGGACGAAAGACAATGTTGATCTTTCATATAACAACCTCACCATAGGGGATACAACTTGTCAACCACGAGGCGGCCTTAACTTGTTTACAAGCTCGTCAAAAAGCAATAGTTCGACAACTGCTTCATGTTTGAAAACTTCAGAGTGTCCAAAACATTTGTACTCTCTCCATATAAATTGTGGTGGGAAACAAGTTACTGTCCCTGGAGAGAAAGATACAGTATATCATGGTGACACATTTCAAGCTGGACCTTCATCATTTTACCAGAGCACAACAAATTGGGCATTAAGCAGCACCGGTTACTTCCCTGATGACGACCAAACTGCGGACACCTTTATATCGACTAATGAAACTAGACTCTCTATGACCGATCCATCAACTGTACATGAACGCTCGCCTTTCTCCCATCTCTCTAACTTATTTTGGGTTTTGTCTGGGAAATGGAAACTACACTGTAAGCCTCCATTTTGCAGAGATAATGTTTAG

Protein Analysis

377

Amino Acids

41.97

Weight (kDa)

8.52

Isoelectric Point (pI)

30.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 4 cut(s) 198, 333, 717, 971
AclWI GGATC 2 cut(s) 157, 1010
AcuI CTGAAG 1 cut(s) 768
AfaI GTAC 3 cut(s) 639, 806, 1029
AfiI CCNNNNNNNGG 2 cut(s) 716, 970
AflIII ACRYGT 1 cut(s) 634
AgeI ACCGGT 1 cut(s) 941
AgsI TTSAA 4 cut(s) 311, 526, 778, 887
AjiI CACGTC 1 cut(s) 635
AjnI CCWGG 1 cut(s) 847
Alw21I GWGCWC 3 cut(s) 9, 73, 917
AlwI GGATC 2 cut(s) 157, 1010
Ama87I CYCGRG 1 cut(s) 138
AoxI GGCC 3 cut(s) 156, 344, 718
ApeKI GCWGC 1 cut(s) 936
AsiGI ACCGGT 1 cut(s) 941
Asp700I GAANNNNTTC 1 cut(s) 119
AspS9I GGNCC 5 cut(s) 128, 156, 344, 410, 893
AsuHPI GGTGA 4 cut(s) 74, 411, 676, 887
AsuNHI GCTAGC 1 cut(s) 329
AvaI CYCGRG 1 cut(s) 138
AvaII GGWCC 3 cut(s) 128, 410, 893
BanII GRGCYC 2 cut(s) 9, 73
BauI CACGAG 1 cut(s) 711
BbsI GAAGAC 1 cut(s) 461
Bbv12I GWGCWC 3 cut(s) 9, 73, 917
BbvCI CCTCAGC 1 cut(s) 539
BbvI GCAGC 1 cut(s) 948
BccI CCATC 2 cut(s) 1027, 1059
BcgI CGANNNNNNTGC 2 cut(s) 950, 984
BciT130I CCWGG 1 cut(s) 849
BciVI GTATCC 1 cut(s) 688
BfaI CTAG 4 cut(s) 330, 582, 587, 999
BfmI CTRYAG 1 cut(s) 90
BfuI GTATCC 1 cut(s) 688
BisI GCNGC 2 cut(s) 718, 937
BlsI GCNGC 2 cut(s) 719, 938
Bme1390I CCNGG 1 cut(s) 849
Bme18I GGWCC 3 cut(s) 128, 410, 893
BmeT110I CYCGRG 1 cut(s) 138
BmgBI CACGTC 1 cut(s) 635
BmgT120I GGNCC 5 cut(s) 128, 156, 344, 410, 893
BmrFI CCNGG 1 cut(s) 849
BmtI GCTAGC 1 cut(s) 333
BpiI GAAGAC 1 cut(s) 461
BpmI CTGGAG 1 cut(s) 870
Bpu10I CCTNAGC 1 cut(s) 539
BpuEI CTTGAG 3 cut(s) 409, 424, 527
BsaJI CCNNGG 2 cut(s) 137, 847
BsaWI WCCGGW 2 cut(s) 557, 941
Bsc4I CCNNNNNNNGG 2 cut(s) 716, 970
Bse118I RCCGGY 1 cut(s) 941
Bse1I ACTGG 4 cut(s) 302, 490, 619, 634
BseBI CCWGG 1 cut(s) 849
BseDI CCNNGG 2 cut(s) 137, 847
BseLI CCNNNNNNNGG 2 cut(s) 716, 970
BseMII CTCAG 1 cut(s) 553
BseNI ACTGG 4 cut(s) 302, 490, 619, 634
BseXI GCAGC 1 cut(s) 948
BshFI GGCC 3 cut(s) 158, 346, 720
BshTI ACCGGT 1 cut(s) 941
BsiHKAI GWGCWC 3 cut(s) 9, 73, 917
BsiHKCI CYCGRG 1 cut(s) 138
BsiSI CCGG 2 cut(s) 558, 942
BslFI GGGAC 2 cut(s) 116, 830
BslI CCNNNNNNNGG 2 cut(s) 716, 970
BsmFI GGGAC 2 cut(s) 116, 830
BsnI GGCC 3 cut(s) 158, 346, 720
BsoBI CYCGRG 1 cut(s) 138
Bsp1286I GDGCHC 3 cut(s) 9, 73, 917
Bsp1407I TGTACA 1 cut(s) 1027
Bsp143I GATC 3 cut(s) 149, 664, 1015
BspACI CCGC 4 cut(s) 198, 333, 717, 971
BspANI GGCC 3 cut(s) 158, 346, 720
BspCNI CTCAG 1 cut(s) 552
BspMAI CTGCAG 1 cut(s) 94
BspOI GCTAGC 1 cut(s) 333
BspPI GGATC 2 cut(s) 157, 1010
BsrFI RCCGGY 1 cut(s) 941
BsrGI TGTACA 1 cut(s) 1027
BsrI ACTGG 4 cut(s) 302, 490, 619, 634
BssAI RCCGGY 1 cut(s) 941
BssECI CCNNGG 2 cut(s) 137, 847
BssMI GATC 3 cut(s) 149, 664, 1015
BssSI CACGAG 1 cut(s) 711
Bst2BI CACGAG 1 cut(s) 711
Bst2UI CCWGG 1 cut(s) 849
Bst4CI ACNGT 6 cut(s) 260, 492, 844, 865, 1027, 1100
Bst6I CTCTTC 1 cut(s) 16
BstAUI TGTACA 1 cut(s) 1027
BstC8I GCNNGC 2 cut(s) 331, 1040
BstDEI CTNAG 1 cut(s) 539
BstKTI GATC 3 cut(s) 152, 667, 1018
BstMBI GATC 3 cut(s) 149, 664, 1015
BstNI CCWGG 1 cut(s) 849
BstSCI CCNGG 1 cut(s) 847
BstSFI CTRYAG 1 cut(s) 90
BstV1I GCAGC 1 cut(s) 948
BstV2I GAAGAC 1 cut(s) 461
BstX2I RGATCY 1 cut(s) 149
BstYI RGATCY 1 cut(s) 149
BsuI GTATCC 1 cut(s) 688
BsuRI GGCC 3 cut(s) 158, 346, 720
BtrI CACGTC 1 cut(s) 635
BtsIMutI CAGTG 3 cut(s) 396, 458, 1096
Cac8I GCNNGC 2 cut(s) 331, 1040
Cfr10I RCCGGY 1 cut(s) 941
Cfr13I GGNCC 5 cut(s) 128, 156, 344, 410, 893
Csp6I GTAC 3 cut(s) 638, 805, 1028
CspAI ACCGGT 1 cut(s) 941
CviAII CATG 4 cut(s) 451, 771, 872, 1031
CviQI GTAC 3 cut(s) 638, 805, 1028
DdeI CTNAG 1 cut(s) 539
DpnI GATC 3 cut(s) 151, 666, 1017
DpnII GATC 3 cut(s) 149, 664, 1015
Eam1104I CTCTTC 1 cut(s) 16
EarI CTCTTC 1 cut(s) 16
Ecl136II GAGCTC 2 cut(s) 7, 71
Eco24I GRGCYC 2 cut(s) 9, 73
Eco47I GGWCC 3 cut(s) 128, 410, 893
Eco53kI GAGCTC 2 cut(s) 7, 71
Eco57I CTGAAG 1 cut(s) 768
Eco88I CYCGRG 1 cut(s) 138
EcoICRI GAGCTC 2 cut(s) 7, 71
EcoRII CCWGG 1 cut(s) 847
EcoT38I GRGCYC 2 cut(s) 9, 73
FaeI CATG 4 cut(s) 454, 774, 875, 1034
FaqI GGGAC 2 cut(s) 116, 830
FatI CATG 4 cut(s) 450, 770, 871, 1030
FauI CCCGC 1 cut(s) 191
Fnu4HI GCNGC 2 cut(s) 718, 937
FriOI GRGCYC 2 cut(s) 9, 73
Fsp4HI GCNGC 2 cut(s) 718, 937
FspBI CTAG 4 cut(s) 330, 582, 587, 999
GluI GCNGC 2 cut(s) 718, 937
GsuI CTGGAG 1 cut(s) 870
HaeIII GGCC 3 cut(s) 158, 346, 720
HapII CCGG 2 cut(s) 558, 942
Hin1II CATG 4 cut(s) 454, 774, 875, 1034
HincII GTYRAC 1 cut(s) 707
HindII GTYRAC 1 cut(s) 707
HindIII AAGCTT 1 cut(s) 224
HinfI GANTC 5 cut(s) 171, 322, 393, 416, 1002
HpaII CCGG 2 cut(s) 558, 942
HphI GGTGA 4 cut(s) 74, 411, 676, 887
Hpy166II GTNNAC 4 cut(s) 410, 638, 707, 732
Hpy188I TCNGA 3 cut(s) 22, 75, 787
Hpy188III TCNNGA 5 cut(s) 126, 140, 308, 506, 569
Hpy8I GTNNAC 4 cut(s) 410, 638, 707, 732
HpyAV CCTTC 2 cut(s) 363, 906
HpyCH4III ACNGT 6 cut(s) 260, 492, 844, 865, 1027, 1100
HpyCH4IV ACGT 1 cut(s) 634
HpyCH4V TGCA 4 cut(s) 92, 221, 477, 1116
HpyF3I CTNAG 1 cut(s) 539
HpySE526I ACGT 1 cut(s) 634
Hsp92II CATG 4 cut(s) 454, 774, 875, 1034
Kzo9I GATC 3 cut(s) 149, 664, 1015
LmnI GCTCC 2 cut(s) 4, 142
Lsp1109I GCAGC 1 cut(s) 948
MaeI CTAG 4 cut(s) 330, 582, 587, 999
MaeII ACGT 1 cut(s) 634
MaeIII GTNAC 6 cut(s) 254, 260, 492, 838, 875, 944
MalI GATC 3 cut(s) 151, 666, 1017
MboI GATC 3 cut(s) 149, 664, 1015
MboII GAAGA 2 cut(s) 3, 466
MflI RGATCY 1 cut(s) 149
MhlI GDGCHC 3 cut(s) 9, 73, 917
MluCI AATT 5 cut(s) 118, 348, 521, 820, 922
MlyI GAGTC 1 cut(s) 996
MmeI TCCRAC 1 cut(s) 17
MnlI CCTC 8 cut(s) 141, 147, 193, 507, 548, 692, 707, 1116
MroXI GAANNNNTTC 1 cut(s) 119
MseI TTAA 5 cut(s) 380, 546, 611, 723, 932
MslI CAYNNNNRTG 1 cut(s) 110
MspI CCGG 2 cut(s) 558, 942
MspR9I CCNGG 1 cut(s) 849
MvaI CCWGG 1 cut(s) 849
NdeII GATC 3 cut(s) 149, 664, 1015
NheI GCTAGC 1 cut(s) 329
NlaIII CATG 4 cut(s) 454, 774, 875, 1034
NmuCI GTSAC 3 cut(s) 254, 260, 875
PdmI GAANNNNTTC 1 cut(s) 119
PfeI GAWTC 4 cut(s) 171, 322, 393, 416
PinAI ACCGGT 1 cut(s) 941
PkrI GCNGC 2 cut(s) 719, 938
PleI GAGTC 1 cut(s) 996
PpsI GAGTC 1 cut(s) 996
Psp124BI GAGCTC 2 cut(s) 9, 73
Psp6I CCWGG 1 cut(s) 847
PspGI CCWGG 1 cut(s) 847
PspPI GGNCC 5 cut(s) 128, 156, 344, 410, 893
PstI CTGCAG 1 cut(s) 94
PsuI RGATCY 1 cut(s) 149
RsaI GTAC 3 cut(s) 639, 806, 1029
RsaNI GTAC 3 cut(s) 638, 805, 1028
RseI CAYNNNNRTG 1 cut(s) 110
SacI GAGCTC 2 cut(s) 9, 73
SaqAI TTAA 5 cut(s) 380, 546, 611, 723, 932
SatI GCNGC 2 cut(s) 718, 937
Sau3AI GATC 3 cut(s) 149, 664, 1015
Sau96I GGNCC 5 cut(s) 128, 156, 344, 410, 893
SchI GAGTC 1 cut(s) 996
ScrFI CCNGG 1 cut(s) 849
SduI GDGCHC 3 cut(s) 9, 73, 917
SfcI CTRYAG 1 cut(s) 90
SinI GGWCC 3 cut(s) 128, 410, 893
SmiMI CAYNNNNRTG 1 cut(s) 110
SmlI CTYRAG 3 cut(s) 388, 403, 506
SmoI CTYRAG 3 cut(s) 388, 403, 506
Sse9I AATT 5 cut(s) 118, 348, 521, 820, 922
SsiI CCGC 4 cut(s) 198, 333, 717, 971
SspMI CTAG 4 cut(s) 330, 582, 587, 999
SstI GAGCTC 2 cut(s) 9, 73
StyD4I CCNGG 1 cut(s) 847
TaaI ACNGT 6 cut(s) 260, 492, 844, 865, 1027, 1100
TaiI ACGT 1 cut(s) 637
TaqI TCGA 3 cut(s) 435, 758, 986
TaqII GACCGA 1 cut(s) 1028
TasI AATT 5 cut(s) 118, 348, 521, 820, 922
TatI WGTACW 2 cut(s) 804, 1027
TauI GCSGC 1 cut(s) 720
TfiI GAWTC 4 cut(s) 171, 322, 393, 416
Tru1I TTAA 5 cut(s) 380, 546, 611, 723, 932
Tru9I TTAA 5 cut(s) 380, 546, 611, 723, 932
TscAI CASTG 3 cut(s) 403, 465, 1103
TseFI GTSAC 3 cut(s) 254, 260, 875
TseI GCWGC 1 cut(s) 936
Tsp45I GTSAC 3 cut(s) 254, 260, 875
TspDTI ATGAA 9 cut(s) 128, 458, 467, 530, 660, 759, 888, 1008, 1047
TspRI CASTG 3 cut(s) 403, 465, 1103
VpaK11BI GGWCC 3 cut(s) 128, 410, 893
XcmI CCANNNNNNNNNTGG 1 cut(s) 821
XmnI GAANNNNTTC 1 cut(s) 119
XspI CTAG 4 cut(s) 330, 582, 587, 999
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.