pycom17g17850

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
OG0000158
Physical Location & Seq
Forward (+)
15403709 .. 15403948
240 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom17g17850.1

Sequence Viewer

Length: 240 bp
ATGGGATTTACATCAGGCAAAGTTTGGATTACCGGTCCAAAAACACATTGCCTTTCCAAGGAATTTAATTCTTCCTGGATTGCATCTTTCCACTTAGGCCAATCTTGTCTCTGTTTGCATTCATCAACGGAGCGGGGCTCAATATCATCACTTAATATGATTTCAGTAGCTACTGCGAATGCGAACATATCATTGATGATTATTTCATTCCGATCCCACAATTCATTTGTACATGCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

80

Amino Acids

8.57

Weight (kDa)

9.1

Isoelectric Point (pI)

46.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 133
AciI CCGC 1 cut(s) 133
AclWI GGATC 1 cut(s) 207
AcsI RAATTY 1 cut(s) 62
AfaI GTAC 1 cut(s) 231
AfiI CCNNNNNNNGG 1 cut(s) 58
AgeI ACCGGT 1 cut(s) 32
AjnI CCWGG 1 cut(s) 74
AluBI AGCT 1 cut(s) 170
AluI AGCT 1 cut(s) 170
Alw26I GTCTC 1 cut(s) 113
AlwI GGATC 1 cut(s) 207
AoxI GGCC 1 cut(s) 97
ApoI RAATTY 1 cut(s) 62
AsiGI ACCGGT 1 cut(s) 32
AspS9I GGNCC 1 cut(s) 35
AvaII GGWCC 1 cut(s) 35
BanII GRGCYC 1 cut(s) 140
BciT130I CCWGG 1 cut(s) 76
BcoDI GTCTC 1 cut(s) 113
Bme1390I CCNGG 1 cut(s) 76
Bme18I GGWCC 1 cut(s) 35
BmgT120I GGNCC 1 cut(s) 35
BmrFI CCNGG 1 cut(s) 76
BmsI GCATC 1 cut(s) 92
BplI GAGNNNNNCTC 2 cut(s) 122, 154
BsaBI GATNNNNATC 1 cut(s) 10
BsaJI CCNNGG 1 cut(s) 57
BsaWI WCCGGW 1 cut(s) 32
Bsc4I CCNNNNNNNGG 1 cut(s) 58
Bse118I RCCGGY 1 cut(s) 32
Bse3DI GCAATG 1 cut(s) 46
Bse8I GATNNNNATC 1 cut(s) 10
BseBI CCWGG 1 cut(s) 76
BseDI CCNNGG 1 cut(s) 57
BseJI GATNNNNATC 1 cut(s) 10
BseLI CCNNNNNNNGG 1 cut(s) 58
BseMI GCAATG 1 cut(s) 46
BshFI GGCC 1 cut(s) 99
BshTI ACCGGT 1 cut(s) 32
BsiSI CCGG 1 cut(s) 33
BslI CCNNNNNNNGG 1 cut(s) 58
BsmAI GTCTC 1 cut(s) 113
BsmI GAATGC 2 cut(s) 118, 184
BsnI GGCC 1 cut(s) 99
Bsp1286I GDGCHC 1 cut(s) 140
Bsp1407I TGTACA 1 cut(s) 229
Bsp143I GATC 1 cut(s) 212
BspACI CCGC 1 cut(s) 133
BspANI GGCC 1 cut(s) 99
BspPI GGATC 1 cut(s) 207
BsrBI CCGCTC 1 cut(s) 133
BsrDI GCAATG 1 cut(s) 46
BsrFI RCCGGY 1 cut(s) 32
BsrGI TGTACA 1 cut(s) 229
BssAI RCCGGY 1 cut(s) 32
BssECI CCNNGG 1 cut(s) 57
BssMI GATC 1 cut(s) 212
BssT1I CCWWGG 1 cut(s) 57
Bst2UI CCWGG 1 cut(s) 76
BstAUI TGTACA 1 cut(s) 229
BstDEI CTNAG 1 cut(s) 94
BstENI CCTNNNNNAGG 1 cut(s) 56
BstKTI GATC 1 cut(s) 215
BstMAI GTCTC 1 cut(s) 113
BstMBI GATC 1 cut(s) 212
BstNI CCWGG 1 cut(s) 76
BstNSI RCATGY 1 cut(s) 236
BstSCI CCNGG 1 cut(s) 74
BsuRI GGCC 1 cut(s) 99
Cfr10I RCCGGY 1 cut(s) 32
Cfr13I GGNCC 1 cut(s) 35
Csp6I GTAC 1 cut(s) 230
CspAI ACCGGT 1 cut(s) 32
CviAII CATG 1 cut(s) 233
CviJI RGCY 3 cut(s) 99, 138, 170
CviKI_1 RGCY 3 cut(s) 99, 138, 170
CviQI GTAC 1 cut(s) 230
DdeI CTNAG 1 cut(s) 94
DpnI GATC 1 cut(s) 214
DpnII GATC 1 cut(s) 212
Eco130I CCWWGG 1 cut(s) 57
Eco24I GRGCYC 1 cut(s) 140
Eco47I GGWCC 1 cut(s) 35
EcoNI CCTNNNNNAGG 1 cut(s) 56
EcoRII CCWGG 1 cut(s) 74
EcoT14I CCWWGG 1 cut(s) 57
EcoT22I ATGCAT 1 cut(s) 238
EcoT38I GRGCYC 1 cut(s) 140
ErhI CCWWGG 1 cut(s) 57
FaeI CATG 1 cut(s) 236
FaiI YATR 4 cut(s) 158, 188, 234, 238
FatI CATG 1 cut(s) 232
FauI CCCGC 1 cut(s) 126
FriOI GRGCYC 1 cut(s) 140
HaeIII GGCC 1 cut(s) 99
HapII CCGG 1 cut(s) 33
Hin1II CATG 1 cut(s) 236
HpaII CCGG 1 cut(s) 33
Hpy188I TCNGA 1 cut(s) 212
HpyCH4V TGCA 3 cut(s) 83, 118, 236
HpyF3I CTNAG 1 cut(s) 94
Hsp92II CATG 1 cut(s) 236
Kzo9I GATC 1 cut(s) 212
LmnI GCTCC 1 cut(s) 130
LpnPI CCDG 3 cut(s) 46, 61, 88
LweI GCATC 1 cut(s) 92
MalI GATC 1 cut(s) 214
MbiI CCGCTC 1 cut(s) 133
MboI GATC 1 cut(s) 212
MboII GAAGA 1 cut(s) 63
MhlI GDGCHC 1 cut(s) 140
MluCI AATT 3 cut(s) 62, 67, 220
Mph1103I ATGCAT 1 cut(s) 238
MseI TTAA 2 cut(s) 66, 153
MspI CCGG 1 cut(s) 33
MspR9I CCNGG 1 cut(s) 76
Mva1269I GAATGC 2 cut(s) 118, 184
MvaI CCWGG 1 cut(s) 76
NdeII GATC 1 cut(s) 212
NlaIII CATG 1 cut(s) 236
NsiI ATGCAT 1 cut(s) 238
NspI RCATGY 1 cut(s) 236
PctI GAATGC 2 cut(s) 118, 184
PfoI TCCNGGA 1 cut(s) 74
PinAI ACCGGT 1 cut(s) 32
Psp6I CCWGG 1 cut(s) 74
PspGI CCWGG 1 cut(s) 74
PspPI GGNCC 1 cut(s) 35
RsaI GTAC 1 cut(s) 231
RsaNI GTAC 1 cut(s) 230
SaqAI TTAA 2 cut(s) 66, 153
Sau3AI GATC 1 cut(s) 212
Sau96I GGNCC 1 cut(s) 35
ScrFI CCNGG 1 cut(s) 76
SduI GDGCHC 1 cut(s) 140
SetI ASST 1 cut(s) 172
SfaNI GCATC 1 cut(s) 92
SgeI CNNG 7 cut(s) 27, 45, 70, 87, 88, 117, 146
SinI GGWCC 1 cut(s) 35
Sse9I AATT 3 cut(s) 62, 67, 220
SsiI CCGC 1 cut(s) 133
StyD4I CCNGG 1 cut(s) 74
StyI CCWWGG 1 cut(s) 57
TasI AATT 3 cut(s) 62, 67, 220
TatI WGTACW 1 cut(s) 229
Tru1I TTAA 2 cut(s) 66, 153
Tru9I TTAA 2 cut(s) 66, 153
TspDTI ATGAA 3 cut(s) 111, 195, 213
TspGWI ACGGA 1 cut(s) 143
VpaK11BI GGWCC 1 cut(s) 35
XagI CCTNNNNNAGG 1 cut(s) 56
XapI RAATTY 1 cut(s) 62
XceI RCATGY 1 cut(s) 236
Zsp2I ATGCAT 1 cut(s) 238
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.