pycom12661g00030

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00012661
OG0000158
Physical Location & Seq
Forward (+)
28361 .. 29061
701 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12661g00030.3

Sequence Viewer

Length: 561 bp
ATGCTCCTATCAAATTTTCCCACACTTAGCTTTTACCTTCCAACATTTACCTCAAGGATTTCCAATGAACATGACACATTAAAGAACACTACTGTCATATCCCGCACGATATTGTCCGCTTTGGGCCCCGACCACGCCCTCACGGTTTTGTTTTTGGGAACTCACACGAGAACTTCGCAGTGGGTCACCCATCATGGGAGTGCTCTCGCGTGCTACTTGCTTAACTTCAGAGTTCCGATGGAACCCGAAGCCAGTGAGCTCCCAAAAGGCCTCGCGTTAGTAAAATCCCTTGGGCAATGTGGGATCTTACAATCCACCCCCCTTAAGGGTCCGACGTTCTCGTCGGCACACACGCGACCAGGGTTAGGCTCTAATACCAAATTGTCACATCCCGGCCCGGGGCGGATCACTTCCCAGGCCCGCTCCACCACCGTAGCACGATATTGTCCGCTCTGGGCTTACCATTCCCTCAGGGTTTTGTTTTTCGGAACTCACGAGCAATTTCCCAGTGAGTCACCTGATGTGATAAATAATAGCACTCAAATTAAACTCTCTTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

187

Amino Acids

20.33

Weight (kDa)

9.55

Isoelectric Point (pI)

34.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 340
AccBSI CCGCTC 2 cut(s) 423, 451
AccII CGCG 3 cut(s) 209, 275, 355
AciI CCGC 5 cut(s) 103, 117, 403, 421, 449
AclWI GGATC 2 cut(s) 311, 413
AcsI RAATTY 1 cut(s) 13
AcuI CTGAAG 1 cut(s) 211
AfiI CCNNNNNNNGG 6 cut(s) 195, 325, 326, 365, 398, 399
AflII CTTAAG 1 cut(s) 323
AjnI CCWGG 2 cut(s) 358, 414
AluBI AGCT 2 cut(s) 30, 259
AluI AGCT 2 cut(s) 30, 259
Alw21I GWGCWC 2 cut(s) 205, 261
AlwI GGATC 2 cut(s) 311, 413
Ama87I CYCGRG 1 cut(s) 397
AoxI GGCC 4 cut(s) 124, 268, 394, 417
ApaI GGGCCC 1 cut(s) 128
ApoI RAATTY 1 cut(s) 13
AspS9I GGNCC 5 cut(s) 124, 125, 329, 395, 418
AsuC2I CCSGG 3 cut(s) 393, 398, 399
AsuHPI GGTGA 2 cut(s) 178, 507
AvaI CYCGRG 1 cut(s) 397
AvaII GGWCC 1 cut(s) 329
AxyI CCTNAGG 1 cut(s) 470
BaeGI GKGCMC 1 cut(s) 128
BanII GRGCYC 2 cut(s) 128, 261
BauI CACGAG 2 cut(s) 166, 494
Bbv12I GWGCWC 2 cut(s) 205, 261
BccI CCATC 2 cut(s) 198, 232
BciT130I CCWGG 2 cut(s) 360, 416
BcnI CCSGG 3 cut(s) 393, 398, 399
BfrI CTTAAG 1 cut(s) 323
Bme1390I CCNGG 5 cut(s) 360, 393, 398, 399, 416
Bme18I GGWCC 1 cut(s) 329
BmeT110I CYCGRG 1 cut(s) 397
BmgT120I GGNCC 5 cut(s) 124, 125, 329, 395, 418
BmiI GGNNCC 4 cut(s) 126, 127, 243, 330
BmrFI CCNGG 5 cut(s) 360, 393, 398, 399, 416
BmrI ACTGGG 1 cut(s) 501
BmuI ACTGGG 1 cut(s) 501
BpuEI CTTGAG 1 cut(s) 37
BpuMI CCSGG 3 cut(s) 393, 398, 399
BsaJI CCNNGG 5 cut(s) 289, 359, 397, 398, 414
Bsc4I CCNNNNNNNGG 6 cut(s) 195, 325, 326, 365, 398, 399
Bse1I ACTGG 2 cut(s) 252, 507
Bse21I CCTNAGG 1 cut(s) 470
Bse3DI GCAATG 1 cut(s) 302
BseBI CCWGG 2 cut(s) 360, 416
BseDI CCNNGG 5 cut(s) 289, 359, 397, 398, 414
BseGI GGATG 1 cut(s) 388
BseLI CCNNNNNNNGG 6 cut(s) 195, 325, 326, 365, 398, 399
BseMI GCAATG 1 cut(s) 302
BseMII CTCAG 1 cut(s) 484
BseNI ACTGG 2 cut(s) 252, 507
BseSI GKGCMC 1 cut(s) 128
Bsh1236I CGCG 3 cut(s) 209, 275, 355
BshFI GGCC 4 cut(s) 126, 270, 396, 419
BsiHKAI GWGCWC 2 cut(s) 205, 261
BsiHKCI CYCGRG 1 cut(s) 397
BsiSI CCGG 2 cut(s) 393, 398
BslI CCNNNNNNNGG 6 cut(s) 195, 325, 326, 365, 398, 399
BsnI GGCC 4 cut(s) 126, 270, 396, 419
BsoBI CYCGRG 1 cut(s) 397
Bsp120I GGGCCC 1 cut(s) 124
Bsp1286I GDGCHC 3 cut(s) 128, 205, 261
Bsp143I GATC 2 cut(s) 303, 405
BspACI CCGC 5 cut(s) 103, 117, 403, 421, 449
BspANI GGCC 4 cut(s) 126, 270, 396, 419
BspCNI CTCAG 1 cut(s) 483
BspFNI CGCG 3 cut(s) 209, 275, 355
BspLI GGNNCC 4 cut(s) 126, 127, 243, 330
BspPI GGATC 2 cut(s) 311, 413
BspTI CTTAAG 1 cut(s) 323
BsrBI CCGCTC 2 cut(s) 423, 451
BsrDI GCAATG 1 cut(s) 302
BsrI ACTGG 2 cut(s) 252, 507
BssECI CCNNGG 5 cut(s) 289, 359, 397, 398, 414
BssMI GATC 2 cut(s) 303, 405
BssSI CACGAG 2 cut(s) 166, 494
BssT1I CCWWGG 1 cut(s) 289
Bst2BI CACGAG 2 cut(s) 166, 494
Bst2UI CCWGG 2 cut(s) 360, 416
Bst4CI ACNGT 3 cut(s) 94, 145, 433
BstAFI CTTAAG 1 cut(s) 323
BstC8I GCNNGC 2 cut(s) 211, 421
BstDEI CTNAG 2 cut(s) 26, 470
BstEII GGTNACC 1 cut(s) 184
BstF5I GGATG 1 cut(s) 388
BstFNI CGCG 3 cut(s) 209, 275, 355
BstKTI GATC 2 cut(s) 306, 408
BstMBI GATC 2 cut(s) 303, 405
BstNI CCWGG 2 cut(s) 360, 416
BstPI GGTNACC 1 cut(s) 184
BstSCI CCNGG 5 cut(s) 358, 391, 396, 397, 414
BstSLI GKGCMC 1 cut(s) 128
BstUI CGCG 3 cut(s) 209, 275, 355
BstX2I RGATCY 1 cut(s) 303
BstYI RGATCY 1 cut(s) 303
Bsu36I CCTNAGG 1 cut(s) 470
BsuRI GGCC 4 cut(s) 126, 270, 396, 419
BtsCI GGATG 1 cut(s) 388
BtsI GCAGTG 1 cut(s) 185
BtsIMutI CAGTG 3 cut(s) 185, 259, 514
Cac8I GCNNGC 2 cut(s) 211, 421
Cfr13I GGNCC 5 cut(s) 124, 125, 329, 395, 418
Cfr9I CCCGGG 1 cut(s) 397
CviAII CATG 2 cut(s) 71, 194
CviJI RGCY 9 cut(s) 30, 126, 251, 259, 270, 369, 396, 419, 458
CviKI_1 RGCY 9 cut(s) 30, 126, 251, 259, 270, 369, 396, 419, 458
DdeI CTNAG 2 cut(s) 26, 470
DpnI GATC 2 cut(s) 305, 407
DpnII GATC 2 cut(s) 303, 405
DrdI GACNNNNNNGTC 1 cut(s) 340
DseDI GACNNNNNNGTC 1 cut(s) 340
EciI GGCGGA 1 cut(s) 418
Ecl136II GAGCTC 1 cut(s) 259
Eco130I CCWWGG 1 cut(s) 289
Eco147I AGGCCT 1 cut(s) 270
Eco24I GRGCYC 2 cut(s) 128, 261
Eco47I GGWCC 1 cut(s) 329
Eco53kI GAGCTC 1 cut(s) 259
Eco57I CTGAAG 1 cut(s) 211
Eco81I CCTNAGG 1 cut(s) 470
Eco88I CYCGRG 1 cut(s) 397
Eco91I GGTNACC 1 cut(s) 184
EcoICRI GAGCTC 1 cut(s) 259
EcoO109I RGGNCCY 1 cut(s) 125
EcoO65I GGTNACC 1 cut(s) 184
EcoRII CCWGG 2 cut(s) 358, 414
EcoT14I CCWWGG 1 cut(s) 289
EcoT38I GRGCYC 2 cut(s) 128, 261
ErhI CCWWGG 1 cut(s) 289
FaeI CATG 2 cut(s) 74, 197
FaiI YATR 3 cut(s) 72, 98, 195
FatI CATG 2 cut(s) 70, 193
FauI CCCGC 2 cut(s) 110, 428
FokI GGATG 1 cut(s) 375
FriOI GRGCYC 2 cut(s) 128, 261
HaeIII GGCC 4 cut(s) 126, 270, 396, 419
HapII CCGG 2 cut(s) 393, 398
Hin1II CATG 2 cut(s) 74, 197
HinfI GANTC 1 cut(s) 512
HpaII CCGG 2 cut(s) 393, 398
HphI GGTGA 2 cut(s) 178, 507
Hpy188I TCNGA 4 cut(s) 230, 237, 333, 488
Hpy188III TCNNGA 2 cut(s) 494, 558
Hpy99I CGWCG 2 cut(s) 337, 346
HpyAV CCTTC 1 cut(s) 47
HpyCH4III ACNGT 3 cut(s) 94, 145, 433
HpyCH4IV ACGT 1 cut(s) 335
HpyF3I CTNAG 2 cut(s) 26, 470
HpySE526I ACGT 1 cut(s) 335
Hsp92II CATG 2 cut(s) 74, 197
Kzo9I GATC 2 cut(s) 303, 405
LmnI GCTCC 3 cut(s) 9, 264, 428
MaeII ACGT 1 cut(s) 335
MaeIII GTNAC 3 cut(s) 184, 384, 513
MalI GATC 2 cut(s) 305, 407
MbiI CCGCTC 2 cut(s) 423, 451
MboI GATC 2 cut(s) 303, 405
MboII GAAGA 1 cut(s) 546
MflI RGATCY 1 cut(s) 303
MhlI GDGCHC 3 cut(s) 128, 205, 261
MluCI AATT 4 cut(s) 13, 380, 500, 543
MlyI GAGTC 1 cut(s) 521
MmeI TCCRAC 2 cut(s) 65, 356
MnlI CCTC 4 cut(s) 61, 149, 281, 479
MseI TTAA 4 cut(s) 80, 222, 324, 546
MslI CAYNNNNRTG 1 cut(s) 198
MspCI CTTAAG 1 cut(s) 323
MspI CCGG 2 cut(s) 393, 398
MspR9I CCNGG 5 cut(s) 360, 393, 398, 399, 416
MvaI CCWGG 2 cut(s) 360, 416
MvnI CGCG 3 cut(s) 209, 275, 355
NciI CCSGG 3 cut(s) 393, 398, 399
NdeII GATC 2 cut(s) 303, 405
NlaIII CATG 2 cut(s) 74, 197
NlaIV GGNNCC 4 cut(s) 126, 127, 243, 330
NmuCI GTSAC 3 cut(s) 184, 384, 513
PceI AGGCCT 1 cut(s) 270
PcsI WCGNNNNNNNCGW 1 cut(s) 492
PleI GAGTC 1 cut(s) 520
PpsI GAGTC 1 cut(s) 520
Psp124BI GAGCTC 1 cut(s) 261
Psp6I CCWGG 2 cut(s) 358, 414
PspEI GGTNACC 1 cut(s) 184
PspGI CCWGG 2 cut(s) 358, 414
PspN4I GGNNCC 4 cut(s) 126, 127, 243, 330
PspOMI GGGCCC 1 cut(s) 124
PspPI GGNCC 5 cut(s) 124, 125, 329, 395, 418
PsuI RGATCY 1 cut(s) 303
RseI CAYNNNNRTG 1 cut(s) 198
SacI GAGCTC 1 cut(s) 261
SaqAI TTAA 4 cut(s) 80, 222, 324, 546
Sau3AI GATC 2 cut(s) 303, 405
Sau96I GGNCC 5 cut(s) 124, 125, 329, 395, 418
SchI GAGTC 1 cut(s) 521
ScrFI CCNGG 5 cut(s) 360, 393, 398, 399, 416
SduI GDGCHC 3 cut(s) 128, 205, 261
SetI ASST 6 cut(s) 32, 39, 53, 261, 338, 520
SinI GGWCC 1 cut(s) 329
SmaI CCCGGG 1 cut(s) 399
SmiMI CAYNNNNRTG 1 cut(s) 198
SmlI CTYRAG 2 cut(s) 52, 323
SmoI CTYRAG 2 cut(s) 52, 323
Sse9I AATT 4 cut(s) 13, 380, 500, 543
SseBI AGGCCT 1 cut(s) 270
SsiI CCGC 5 cut(s) 103, 117, 403, 421, 449
SstI GAGCTC 1 cut(s) 261
StuI AGGCCT 1 cut(s) 270
StyD4I CCNGG 5 cut(s) 358, 391, 396, 397, 414
StyI CCWWGG 1 cut(s) 289
TaaI ACNGT 3 cut(s) 94, 145, 433
TaiI ACGT 1 cut(s) 338
TasI AATT 4 cut(s) 13, 380, 500, 543
Tru1I TTAA 4 cut(s) 80, 222, 324, 546
Tru9I TTAA 4 cut(s) 80, 222, 324, 546
TscAI CASTG 3 cut(s) 185, 259, 514
TseFI GTSAC 3 cut(s) 184, 384, 513
Tsp45I GTSAC 3 cut(s) 184, 384, 513
TspDTI ATGAA 1 cut(s) 81
TspMI CCCGGG 1 cut(s) 397
TspRI CASTG 3 cut(s) 185, 259, 514
Vha464I CTTAAG 1 cut(s) 323
VpaK11BI GGWCC 1 cut(s) 329
XapI RAATTY 1 cut(s) 13
XmaI CCCGGG 1 cut(s) 397
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.