Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr13

Orthogroup ID

OG0000158

Physical Location & Seq

Genomic Coordinates Reverse (-)

5829253 .. 5829486

Gene Structure 234 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom13g08800.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 234 bp

ATGTCACAATCCACCCCCCTTAGGGGCCCGACGTCCTCGTCGGCACACACGCAACCAGGATTAGGCTCTGATACCAAATTGTCACATCCCGGCCCGGGGCGGATCACTTCCCGAGCCTGCTCCACCACCGTAGCACGATATTGTCCGCTTTGGGCTTACCATTCCCTCACGGTTTTGTTTTTGGGAACTCACGAGCAACTTCCCAGTGGGTCACCCATTATGGGATTGCTCTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0003006 GO:0003674 GO:0003824 GO:0004812 GO:0004823 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005739 GO:0006082 GO:0006139 GO:0006399 GO:0006412 GO:0006418 GO:0006429 GO:0006518 GO:0006520 GO:0006725 GO:0006807 GO:0007275 GO:0008150 GO:0008152 GO:0009058 GO:0009059 GO:0009507 GO:0009532 GO:0009536 GO:0009570 GO:0009790 GO:0009791 GO:0009793 GO:0009987 GO:0010154 GO:0010467 GO:0016070 GO:0016874 GO:0016875 GO:0019538 GO:0019752 GO:0022414 GO:0032501 GO:0032502 GO:0032543 GO:0034641 GO:0034645 GO:0034660 GO:0043038 GO:0043039 GO:0043043 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043436 GO:0043603 GO:0043604 GO:0044237 GO:0044238 GO:0044249 GO:0044260 GO:0044267 GO:0044271 GO:0044281 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044444 GO:0044446 GO:0044464 GO:0046483 GO:0048316 GO:0048608 GO:0048731 GO:0048856 GO:0061458 GO:0071704 GO:0090304 GO:0140053 GO:0140098 GO:0140101 GO:1901360 GO:1901564 GO:1901566 GO:1901576

KEGG Pathways

Metabolic & Signaling

ko00970 map00970

Pfam Domains

Protein Families

Anticodon_1 tRNA-synt_1 tRNA-synt_1_2

Protein Analysis

78

Amino Acids

8.11

Weight (kDa)

9.38

Isoelectric Point (pI)

50.76

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g10163
malus_domestica	MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis	pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis	RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	37
AatII	GACGTC	1 cut(s)	35
AciI	CCGC	2 cut(s)	100, 146
AclWI	GGATC	1 cut(s)	110
AcyI	GRCGYC	1 cut(s)	32
AfiI	CCNNNNNNNGG	7 cut(s)	21, 22, 23, 62, 95, 96, 221
AjnI	CCWGG	1 cut(s)	55
AlwI	GGATC	1 cut(s)	110
Ama87I	CYCGRG	2 cut(s)	94, 111
AoxI	GGCC	2 cut(s)	25, 91
ApaI	GGGCCC	1 cut(s)	29
AspS9I	GGNCC	3 cut(s)	25, 26, 92
AsuC2I	CCSGG	3 cut(s)	90, 95, 96
AsuHPI	GGTGA	1 cut(s)	204
AvaI	CYCGRG	2 cut(s)	94, 111
AxyI	CCTNAGG	1 cut(s)	20
BaeGI	GKGCMC	1 cut(s)	29
BanII	GRGCYC	1 cut(s)	29
BauI	CACGAG	1 cut(s)	191
BciT130I	CCWGG	1 cut(s)	57
BcnI	CCSGG	3 cut(s)	90, 95, 96
BfaI	CTAG	1 cut(s)	232
Bme1390I	CCNGG	4 cut(s)	57, 90, 95, 96
BmeT110I	CYCGRG	2 cut(s)	94, 111
BmgT120I	GGNCC	3 cut(s)	25, 26, 92
BmiI	GGNNCC	2 cut(s)	26, 27
BmrFI	CCNGG	4 cut(s)	57, 90, 95, 96
BmrI	ACTGGG	1 cut(s)	198
BmuI	ACTGGG	1 cut(s)	198
BpuMI	CCSGG	3 cut(s)	90, 95, 96
BsaHI	GRCGYC	1 cut(s)	32
BsaJI	CCNNGG	2 cut(s)	94, 95
Bsc4I	CCNNNNNNNGG	7 cut(s)	21, 22, 23, 62, 95, 96, 221
Bse1I	ACTGG	1 cut(s)	204
Bse21I	CCTNAGG	1 cut(s)	20
BseBI	CCWGG	1 cut(s)	57
BseDI	CCNNGG	2 cut(s)	94, 95
BseGI	GGATG	1 cut(s)	85
BseLI	CCNNNNNNNGG	7 cut(s)	21, 22, 23, 62, 95, 96, 221
BseNI	ACTGG	1 cut(s)	204
BseSI	GKGCMC	1 cut(s)	29
BshFI	GGCC	2 cut(s)	27, 93
BsiHKCI	CYCGRG	2 cut(s)	94, 111
BsiSI	CCGG	2 cut(s)	90, 95
BslI	CCNNNNNNNGG	7 cut(s)	21, 22, 23, 62, 95, 96, 221
BsnI	GGCC	2 cut(s)	27, 93
BsoBI	CYCGRG	2 cut(s)	94, 111
Bsp120I	GGGCCC	1 cut(s)	25
Bsp1286I	GDGCHC	1 cut(s)	29
Bsp143I	GATC	1 cut(s)	102
BspACI	CCGC	2 cut(s)	100, 146
BspANI	GGCC	2 cut(s)	27, 93
BspLI	GGNNCC	2 cut(s)	26, 27
BspPI	GGATC	1 cut(s)	110
BsrI	ACTGG	1 cut(s)	204
BssECI	CCNNGG	2 cut(s)	94, 95
BssMI	GATC	1 cut(s)	102
BssNI	GRCGYC	1 cut(s)	32
BssSI	CACGAG	1 cut(s)	191
Bst2BI	CACGAG	1 cut(s)	191
Bst2UI	CCWGG	1 cut(s)	57
Bst4CI	ACNGT	2 cut(s)	130, 172
BstACI	GRCGYC	1 cut(s)	32
BstC8I	GCNNGC	1 cut(s)	118
BstDEI	CTNAG	1 cut(s)	20
BstEII	GGTNACC	1 cut(s)	210
BstF5I	GGATG	1 cut(s)	85
BstKTI	GATC	1 cut(s)	105
BstMBI	GATC	1 cut(s)	102
BstNI	CCWGG	1 cut(s)	57
BstPI	GGTNACC	1 cut(s)	210
BstSCI	CCNGG	4 cut(s)	55, 88, 93, 94
BstSLI	GKGCMC	1 cut(s)	29
Bsu36I	CCTNAGG	1 cut(s)	20
BsuRI	GGCC	2 cut(s)	27, 93
BtsCI	GGATG	1 cut(s)	85
BtsIMutI	CAGTG	1 cut(s)	211
Cac8I	GCNNGC	1 cut(s)	118
Cfr13I	GGNCC	3 cut(s)	25, 26, 92
Cfr9I	CCCGGG	1 cut(s)	94
CviJI	RGCY	5 cut(s)	27, 66, 93, 116, 155
CviKI_1	RGCY	5 cut(s)	27, 66, 93, 116, 155
DdeI	CTNAG	1 cut(s)	20
DpnI	GATC	1 cut(s)	104
DpnII	GATC	1 cut(s)	102
DrdI	GACNNNNNNGTC	1 cut(s)	37
DseDI	GACNNNNNNGTC	1 cut(s)	37
EciI	GGCGGA	1 cut(s)	115
Eco24I	GRGCYC	1 cut(s)	29
Eco81I	CCTNAGG	1 cut(s)	20
Eco88I	CYCGRG	2 cut(s)	94, 111
Eco91I	GGTNACC	1 cut(s)	210
EcoO109I	RGGNCCY	1 cut(s)	25
EcoO65I	GGTNACC	1 cut(s)	210
EcoRII	CCWGG	1 cut(s)	55
EcoT38I	GRGCYC	1 cut(s)	29
FaiI	YATR	1 cut(s)	221
FokI	GGATG	1 cut(s)	72
FriOI	GRGCYC	1 cut(s)	29
FspBI	CTAG	1 cut(s)	232
HaeIII	GGCC	2 cut(s)	27, 93
HapII	CCGG	2 cut(s)	90, 95
Hin1I	GRCGYC	1 cut(s)	32
HpaII	CCGG	2 cut(s)	90, 95
HphI	GGTGA	1 cut(s)	204
Hpy188I	TCNGA	1 cut(s)	70
Hpy188III	TCNNGA	2 cut(s)	111, 191
Hpy99I	CGWCG	2 cut(s)	34, 43
HpyCH4III	ACNGT	2 cut(s)	130, 172
HpyCH4IV	ACGT	1 cut(s)	32
HpyF3I	CTNAG	1 cut(s)	20
HpySE526I	ACGT	1 cut(s)	32
Hsp92I	GRCGYC	1 cut(s)	32
Kzo9I	GATC	1 cut(s)	102
LmnI	GCTCC	1 cut(s)	125
LpnPI	CCDG	6 cut(s)	42, 69, 103, 108, 130, 217
MaeI	CTAG	1 cut(s)	232
MaeII	ACGT	1 cut(s)	32
MaeIII	GTNAC	3 cut(s)	3, 81, 210
MalI	GATC	1 cut(s)	104
MboI	GATC	1 cut(s)	102
MhlI	GDGCHC	1 cut(s)	29
MluCI	AATT	1 cut(s)	77
MnlI	CCTC	2 cut(s)	46, 176
MspI	CCGG	2 cut(s)	90, 95
MspR9I	CCNGG	4 cut(s)	57, 90, 95, 96
MvaI	CCWGG	1 cut(s)	57
NciI	CCSGG	3 cut(s)	90, 95, 96
NdeII	GATC	1 cut(s)	102
NlaIV	GGNNCC	2 cut(s)	26, 27
NmuCI	GTSAC	3 cut(s)	3, 81, 210
Psp6I	CCWGG	1 cut(s)	55
PspEI	GGTNACC	1 cut(s)	210
PspGI	CCWGG	1 cut(s)	55
PspN4I	GGNNCC	2 cut(s)	26, 27
PspOMI	GGGCCC	1 cut(s)	25
PspPI	GGNCC	3 cut(s)	25, 26, 92
Sau3AI	GATC	1 cut(s)	102
Sau96I	GGNCC	3 cut(s)	25, 26, 92
ScrFI	CCNGG	4 cut(s)	57, 90, 95, 96
SduI	GDGCHC	1 cut(s)	29
SetI	ASST	1 cut(s)	35
SmaI	CCCGGG	1 cut(s)	96
Sse9I	AATT	1 cut(s)	77
SsiI	CCGC	2 cut(s)	100, 146
SspMI	CTAG	1 cut(s)	232
StyD4I	CCNGG	4 cut(s)	55, 88, 93, 94
TaaI	ACNGT	2 cut(s)	130, 172
TaiI	ACGT	1 cut(s)	35
TasI	AATT	1 cut(s)	77
TscAI	CASTG	1 cut(s)	211
TseFI	GTSAC	3 cut(s)	3, 81, 210
Tsp45I	GTSAC	3 cut(s)	3, 81, 210
TspMI	CCCGGG	1 cut(s)	94
TspRI	CASTG	1 cut(s)	211
XmaI	CCCGGG	1 cut(s)	94
XspI	CTAG	1 cut(s)	232
ZraI	GACGTC	1 cut(s)	33

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.