Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr13

Orthogroup ID

OG0000158

Physical Location & Seq

Genomic Coordinates Forward (+)

21657776 .. 21658418

Gene Structure 643 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom13g24570.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 555 bp

ATGGGCAATACCTCGCTACCAAACGATGACCAACTAGTGAAACTCCAATTGTCACATCCCGACCTAAGGCGGATCACTTCCCGAGCCTGCTTCACCACCGTAACACTATATTGTCCGCTTTGGGCCTCGACCACGCCCTCACGGTTTTGTTTCTGGGAACTCACACGAGAACTTCCCAATGGGTCACCCATCCTGGGAATGCTCTCGCGCGCTACTCACTTAACTTCGGAGTTCCCATGGAACCTGAAGCTAGTTAGATCGCTTGTTGAGCCCCTAAGCGACGTGGGATGTCACAATCCACCCCCCTTAGGGGCCCGACGTCCTCTGTCACATCCTGGCCTGAGGCGGATCACTTCCCGGGCTCGCTTCACCACCGTAACACGATATTGTCCGCTTTGGGCCCCGACCACGCCCTTACGGTTTTGTTTTTGGGAACTCACACGAGAACTTCCCAATGGGTCACCCATCTTGGGAGTGCTCTCGCGCGCTACTCGCTTAACTTCGGAGTTCCCATGGAACCCGAAGCCAGTTAGCTCCCAAAAGGCCTCGTGCTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0003006 GO:0003674 GO:0003824 GO:0004812 GO:0004823 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005739 GO:0006082 GO:0006139 GO:0006399 GO:0006412 GO:0006418 GO:0006429 GO:0006518 GO:0006520 GO:0006725 GO:0006807 GO:0007275 GO:0008150 GO:0008152 GO:0009058 GO:0009059 GO:0009507 GO:0009532 GO:0009536 GO:0009570 GO:0009790 GO:0009791 GO:0009793 GO:0009987 GO:0010154 GO:0010467 GO:0016070 GO:0016874 GO:0016875 GO:0019538 GO:0019752 GO:0022414 GO:0032501 GO:0032502 GO:0032543 GO:0034641 GO:0034645 GO:0034660 GO:0043038 GO:0043039 GO:0043043 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043436 GO:0043603 GO:0043604 GO:0044237 GO:0044238 GO:0044249 GO:0044260 GO:0044267 GO:0044271 GO:0044281 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044444 GO:0044446 GO:0044464 GO:0046483 GO:0048316 GO:0048608 GO:0048731 GO:0048856 GO:0061458 GO:0071704 GO:0090304 GO:0140053 GO:0140098 GO:0140101 GO:1901360 GO:1901564 GO:1901566 GO:1901576

KEGG Pathways

Metabolic & Signaling

ko00970 map00970

Pfam Domains

Protein Families

Anticodon_1 tRNA-synt_1 tRNA-synt_1_2

Protein Analysis

185

Amino Acids

20.78

Weight (kDa)

10.09

Isoelectric Point (pI)

58.92

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g10163
malus_domestica	MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis	pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis	RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	322
AccII	CGCG	4 cut(s)	208, 210, 484, 486
AciI	CCGC	4 cut(s)	70, 116, 346, 392
AclWI	GGATC	2 cut(s)	80, 356
AcuI	CTGAAG	1 cut(s)	266
AcyI	GRCGYC	1 cut(s)	319
AfiI	CCNNNNNNNGG	6 cut(s)	66, 194, 308, 309, 310, 470
AhlI	ACTAGT	1 cut(s)	34
AjiI	CACGTC	1 cut(s)	283
AjnI	CCWGG	2 cut(s)	192, 334
AluBI	AGCT	2 cut(s)	250, 534
AluI	AGCT	2 cut(s)	250, 534
Alw21I	GWGCWC	1 cut(s)	480
AlwI	GGATC	2 cut(s)	80, 356
Ama87I	CYCGRG	2 cut(s)	81, 357
AoxI	GGCC	5 cut(s)	123, 312, 337, 399, 543
ApaI	GGGCCC	2 cut(s)	316, 403
AspLEI	GCGC	4 cut(s)	210, 212, 486, 488
AspS9I	GGNCC	5 cut(s)	123, 312, 313, 399, 400
AsuC2I	CCSGG	2 cut(s)	358, 359
AsuHPI	GGTGA	4 cut(s)	85, 177, 361, 453
AvaI	CYCGRG	2 cut(s)	81, 357
AxyI	CCTNAGG	3 cut(s)	65, 307, 341
BaeGI	GKGCMC	2 cut(s)	316, 403
BanII	GRGCYC	4 cut(s)	273, 316, 364, 403
BauI	CACGAG	3 cut(s)	165, 441, 547
Bbv12I	GWGCWC	1 cut(s)	480
BccI	CCATC	2 cut(s)	197, 473
BciT130I	CCWGG	2 cut(s)	194, 336
BcnI	CCSGG	2 cut(s)	358, 359
BcuI	ACTAGT	1 cut(s)	34
BfaI	CTAG	3 cut(s)	35, 251, 553
Bme1390I	CCNGG	4 cut(s)	194, 336, 358, 359
BmeT110I	CYCGRG	2 cut(s)	81, 357
BmgBI	CACGTC	1 cut(s)	283
BmgT120I	GGNCC	5 cut(s)	123, 312, 313, 399, 400
BmiI	GGNNCC	6 cut(s)	242, 313, 314, 401, 402, 518
BmrFI	CCNGG	4 cut(s)	194, 336, 358, 359
Bpu10I	CCTNAGC	1 cut(s)	275
BpuMI	CCSGG	2 cut(s)	358, 359
BsaHI	GRCGYC	1 cut(s)	319
BsaJI	CCNNGG	4 cut(s)	193, 236, 357, 512
Bsc4I	CCNNNNNNNGG	6 cut(s)	66, 194, 308, 309, 310, 470
Bse1I	ACTGG	1 cut(s)	527
Bse21I	CCTNAGG	3 cut(s)	65, 307, 341
BseBI	CCWGG	2 cut(s)	194, 336
BseDI	CCNNGG	4 cut(s)	193, 236, 357, 512
BseGI	GGATG	4 cut(s)	55, 189, 293, 331
BseLI	CCNNNNNNNGG	6 cut(s)	66, 194, 308, 309, 310, 470
BseMII	CTCAG	1 cut(s)	332
BseNI	ACTGG	1 cut(s)	527
BsePI	GCGCGC	2 cut(s)	208, 484
BseSI	GKGCMC	2 cut(s)	316, 403
Bsh1236I	CGCG	4 cut(s)	208, 210, 484, 486
BshFI	GGCC	5 cut(s)	125, 314, 339, 401, 545
BsiHKAI	GWGCWC	1 cut(s)	480
BsiHKCI	CYCGRG	2 cut(s)	81, 357
BsiSI	CCGG	1 cut(s)	358
BslI	CCNNNNNNNGG	6 cut(s)	66, 194, 308, 309, 310, 470
BsmI	GAATGC	1 cut(s)	204
BsnI	GGCC	5 cut(s)	125, 314, 339, 401, 545
BsoBI	CYCGRG	2 cut(s)	81, 357
Bsp120I	GGGCCC	2 cut(s)	312, 399
Bsp1286I	GDGCHC	5 cut(s)	273, 316, 364, 403, 480
Bsp143I	GATC	3 cut(s)	72, 257, 348
Bsp19I	CCATGG	2 cut(s)	236, 512
BspACI	CCGC	4 cut(s)	70, 116, 346, 392
BspANI	GGCC	5 cut(s)	125, 314, 339, 401, 545
BspCNI	CTCAG	1 cut(s)	333
BspFNI	CGCG	4 cut(s)	208, 210, 484, 486
BspLI	GGNNCC	6 cut(s)	242, 313, 314, 401, 402, 518
BspPI	GGATC	2 cut(s)	80, 356
BsrI	ACTGG	1 cut(s)	527
BssECI	CCNNGG	4 cut(s)	193, 236, 357, 512
BssHII	GCGCGC	2 cut(s)	208, 484
BssMI	GATC	3 cut(s)	72, 257, 348
BssNI	GRCGYC	1 cut(s)	319
BssSI	CACGAG	3 cut(s)	165, 441, 547
BssT1I	CCWWGG	2 cut(s)	236, 512
Bst2BI	CACGAG	3 cut(s)	165, 441, 547
Bst2UI	CCWGG	2 cut(s)	194, 336
Bst4CI	ACNGT	4 cut(s)	100, 144, 376, 420
BstACI	GRCGYC	1 cut(s)	319
BstC8I	GCNNGC	4 cut(s)	88, 210, 364, 486
BstDEI	CTNAG	4 cut(s)	65, 275, 307, 341
BstDSI	CCRYGG	2 cut(s)	236, 512
BstEII	GGTNACC	2 cut(s)	183, 459
BstF5I	GGATG	4 cut(s)	55, 189, 293, 331
BstFNI	CGCG	4 cut(s)	208, 210, 484, 486
BstHHI	GCGC	4 cut(s)	210, 212, 486, 488
BstKTI	GATC	3 cut(s)	75, 260, 351
BstMBI	GATC	3 cut(s)	72, 257, 348
BstMWI	GCNNNNNNNGC	2 cut(s)	268, 492
BstNI	CCWGG	2 cut(s)	194, 336
BstPI	GGTNACC	2 cut(s)	183, 459
BstSCI	CCNGG	4 cut(s)	192, 334, 356, 357
BstSLI	GKGCMC	2 cut(s)	316, 403
BstUI	CGCG	4 cut(s)	208, 210, 484, 486
Bsu36I	CCTNAGG	3 cut(s)	65, 307, 341
BsuRI	GGCC	5 cut(s)	125, 314, 339, 401, 545
BtgI	CCRYGG	2 cut(s)	236, 512
BtrI	CACGTC	1 cut(s)	283
BtsCI	GGATG	4 cut(s)	55, 189, 293, 331
Cac8I	GCNNGC	4 cut(s)	88, 210, 364, 486
CfoI	GCGC	4 cut(s)	210, 212, 486, 488
Cfr13I	GGNCC	5 cut(s)	123, 312, 313, 399, 400
Cfr9I	CCCGGG	1 cut(s)	357
CviAII	CATG	2 cut(s)	237, 513
DdeI	CTNAG	4 cut(s)	65, 275, 307, 341
DpnI	GATC	3 cut(s)	74, 259, 350
DpnII	GATC	3 cut(s)	72, 257, 348
EciI	GGCGGA	2 cut(s)	85, 361
Eco130I	CCWWGG	2 cut(s)	236, 512
Eco147I	AGGCCT	1 cut(s)	545
Eco24I	GRGCYC	4 cut(s)	273, 316, 364, 403
Eco57I	CTGAAG	1 cut(s)	266
Eco81I	CCTNAGG	3 cut(s)	65, 307, 341
Eco88I	CYCGRG	2 cut(s)	81, 357
Eco91I	GGTNACC	2 cut(s)	183, 459
EcoO109I	RGGNCCY	2 cut(s)	312, 400
EcoO65I	GGTNACC	2 cut(s)	183, 459
EcoRII	CCWGG	2 cut(s)	192, 334
EcoT14I	CCWWGG	2 cut(s)	236, 512
EcoT38I	GRGCYC	4 cut(s)	273, 316, 364, 403
ErhI	CCWWGG	2 cut(s)	236, 512
FaeI	CATG	2 cut(s)	240, 516
FaiI	YATR	3 cut(s)	109, 238, 514
FatI	CATG	2 cut(s)	236, 512
FokI	GGATG	4 cut(s)	42, 176, 300, 318
FriOI	GRGCYC	4 cut(s)	273, 316, 364, 403
FspBI	CTAG	3 cut(s)	35, 251, 553
GlaI	GCGC	4 cut(s)	209, 211, 485, 487
HaeIII	GGCC	5 cut(s)	125, 314, 339, 401, 545
HapII	CCGG	1 cut(s)	358
HhaI	GCGC	4 cut(s)	210, 212, 486, 488
Hin1I	GRCGYC	1 cut(s)	319
Hin1II	CATG	2 cut(s)	240, 516
Hin6I	GCGC	4 cut(s)	208, 210, 484, 486
HinP1I	GCGC	4 cut(s)	208, 210, 484, 486
HpaII	CCGG	1 cut(s)	358
HphI	GGTGA	4 cut(s)	85, 177, 361, 453
Hpy188I	TCNGA	2 cut(s)	229, 505
Hpy188III	TCNNGA	2 cut(s)	59, 81
Hpy99I	CGWCG	2 cut(s)	284, 321
HpyCH4III	ACNGT	4 cut(s)	100, 144, 376, 420
HpyCH4IV	ACGT	2 cut(s)	282, 319
HpyF10VI	GCNNNNNNNGC	2 cut(s)	268, 492
HpyF3I	CTNAG	4 cut(s)	65, 275, 307, 341
HpySE526I	ACGT	2 cut(s)	282, 319
Hsp92I	GRCGYC	1 cut(s)	319
Hsp92II	CATG	2 cut(s)	240, 516
HspAI	GCGC	4 cut(s)	208, 210, 484, 486
Kzo9I	GATC	3 cut(s)	72, 257, 348
LmnI	GCTCC	1 cut(s)	539
MaeI	CTAG	3 cut(s)	35, 251, 553
MaeII	ACGT	2 cut(s)	282, 319
MaeIII	GTNAC	7 cut(s)	51, 100, 183, 290, 327, 376, 459
MalI	GATC	3 cut(s)	74, 259, 350
MboI	GATC	3 cut(s)	72, 257, 348
MfeI	CAATTG	1 cut(s)	47
MhlI	GDGCHC	5 cut(s)	273, 316, 364, 403, 480
MluCI	AATT	1 cut(s)	47
MnlI	CCTC	5 cut(s)	22, 136, 148, 333, 336
MseI	TTAA	2 cut(s)	221, 497
MspI	CCGG	1 cut(s)	358
MspR9I	CCNGG	4 cut(s)	194, 336, 358, 359
MunI	CAATTG	1 cut(s)	47
Mva1269I	GAATGC	1 cut(s)	204
MvaI	CCWGG	2 cut(s)	194, 336
MvnI	CGCG	4 cut(s)	208, 210, 484, 486
MwoI	GCNNNNNNNGC	2 cut(s)	268, 492
NciI	CCSGG	2 cut(s)	358, 359
NcoI	CCATGG	2 cut(s)	236, 512
NdeII	GATC	3 cut(s)	72, 257, 348
NlaIII	CATG	2 cut(s)	240, 516
NlaIV	GGNNCC	6 cut(s)	242, 313, 314, 401, 402, 518
NmuCI	GTSAC	5 cut(s)	51, 183, 290, 327, 459
PauI	GCGCGC	2 cut(s)	208, 484
PceI	AGGCCT	1 cut(s)	545
PctI	GAATGC	1 cut(s)	204
Psp6I	CCWGG	2 cut(s)	192, 334
PspEI	GGTNACC	2 cut(s)	183, 459
PspGI	CCWGG	2 cut(s)	192, 334
PspN4I	GGNNCC	6 cut(s)	242, 313, 314, 401, 402, 518
PspOMI	GGGCCC	2 cut(s)	312, 399
PspPI	GGNCC	5 cut(s)	123, 312, 313, 399, 400
PteI	GCGCGC	2 cut(s)	208, 484
SaqAI	TTAA	2 cut(s)	221, 497
Sau3AI	GATC	3 cut(s)	72, 257, 348
Sau96I	GGNCC	5 cut(s)	123, 312, 313, 399, 400
ScrFI	CCNGG	4 cut(s)	194, 336, 358, 359
SduI	GDGCHC	5 cut(s)	273, 316, 364, 403, 480
SetI	ASST	7 cut(s)	14, 66, 246, 252, 285, 322, 536
SmaI	CCCGGG	1 cut(s)	359
SpeI	ACTAGT	1 cut(s)	34
Sse9I	AATT	1 cut(s)	47
SseBI	AGGCCT	1 cut(s)	545
SsiI	CCGC	4 cut(s)	70, 116, 346, 392
SspMI	CTAG	3 cut(s)	35, 251, 553
StuI	AGGCCT	1 cut(s)	545
StyD4I	CCNGG	4 cut(s)	192, 334, 356, 357
StyI	CCWWGG	2 cut(s)	236, 512
TaaI	ACNGT	4 cut(s)	100, 144, 376, 420
TaiI	ACGT	2 cut(s)	285, 322
TaqI	TCGA	1 cut(s)	128
TasI	AATT	1 cut(s)	47
Tru1I	TTAA	2 cut(s)	221, 497
Tru9I	TTAA	2 cut(s)	221, 497
TseFI	GTSAC	5 cut(s)	51, 183, 290, 327, 459
Tsp45I	GTSAC	5 cut(s)	51, 183, 290, 327, 459
TspMI	CCCGGG	1 cut(s)	357
XmaI	CCCGGG	1 cut(s)	357
XspI	CTAG	3 cut(s)	35, 251, 553
ZraI	GACGTC	1 cut(s)	320

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.