pycom01g00750

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
OG0000158
Physical Location & Seq
Forward (+)
733867 .. 736185
2319 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g00750.13

Sequence Viewer

Length: 1641 bp
ATGTGTCAACGAAAGAATGGTCTCATGAATCTAACTTCTTTAGATCGCATTCTTCCAATCACATATTCCTTGGACTTATCGTTTAATAGTTTAACATGTGAAATGTCCATAAAGTATCATCATATGATTGGTTTTAGGGCACATTTCCAACAATCTCCCACTTGCACTAGAGCCAATCAGCTTATAGTCGGCCTAGACAATGGATATCTATATGTTATCCATAGAAGCAACCTTGAGAATAACGACGTCACCATTATACATGATTCTCAATCATGTGGTTCAGTCTCTCATTTGAGTTCGGACCTTGATGAGACCTTGATTCCCTGGCTTGAGCTATCAGAGTTCATAAATGAACTTTCCCATCCAAACAACATTGTTGTAAACTTCTATATGGCAATATATTTTGCAATCATAATGGAACACACTAAAGTCATTACTTTAATGTTTCCATCCAAATACCTTTTAGTCATAATAAAGAGATATCTTCATAATCTAATACATTTACGCTTCCATTACGTTACTCTAATTCTTTCTCAATTATTGAGTAATATATCCTTTAGTATTTCTCAAATACTTAAGGACTCACTTGACAGTTGCCATGGTTCTGATCCTGGGCTTGCACTGATATTGTCTTGTACCTTTCTAGGTACATCTTATATCAATAAAGGATTGTATTTACGCATTATTTCTTTGGGAGTCAAAGGGTACATTCCCTTTGAGAAGAACAACTTCCTACATCTCTTGTCTATTTTAGGGATTGATATAATCCAATTATATCTTGAAATATATCATTATAGATTTCCATTCCATTATATAGACTATATCTCCCATATACATTTTATCATCATATATATATATATATATATATATATATATTTAAATTTAGGAATACGATTAACTCCCACTAATCTTTTCAAACAATTGATCTTTTCTCATAAGACGCTTATAGCTCCCACTAGCTTGCTAAGATCCATGATGGATGGATCTCTACAACTAACCTTTCTTAATGGTTTCGGAAACCCATATTATGTCCAAACATTAAATCACCATTTAGTTGTAGCTAGGTTTCTTCAAAGTCAACCATTCTCTTTGAGTGTAGTCATCTTAAGCTACCAATTAGCTGTGAAGGTTTCATTATTTCGGGTCAAATGGTACTTTACCATTTCCTTGAGTATATATCGTATATACACTCAATGTAGTCATAAGGATTTTCATTCTTATTTCTTTCAAATTAAGAGGTGCAACTCTATGACATACCTTCTGGACTACCTTGGAGCTTGTGGTATAGGAACTAGAATGTCCAACGAACTAAATCTTATTCATGTTCATTCTTCTCCTAATGGAGAAATTCATTATCTTACGATGCTACTTTCTTTGATATTTTTCAAGGAAATTAACCTAAAGTACGTCTTACTCATCTACTTACATTTCTTGAATTCTTTGAAACCTTTTGCAAAGTATTCGGACTTGTGTTTATTCAAAATAAACTATAGTCCAACCGAGAGTGATCTTCGTAACCTCAACAACTTTGTGATTCTTTCTTCTTTCCAAAAGAATAAAGATTCGAACATTTCGCCTCTATACAATTTTAACAAGAAGGTATTGGATCCGGATCTAACGATCCAAAGCATCCATCTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

547

Amino Acids

63.47

Weight (kDa)

8.77

Isoelectric Point (pI)

43.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 249
AccIII TCCGGA 1 cut(s) 1609
AclWI GGATC 7 cut(s) 602, 963, 991, 1601, 1614, 1615, 1620
AcsI RAATTY 3 cut(s) 880, 1347, 1435
AcyI GRCGYC 1 cut(s) 246
AfaI GTAC 5 cut(s) 637, 649, 707, 1154, 1406
AflII CTTAAG 2 cut(s) 575, 1105
AflIII ACRYGT 1 cut(s) 95
AgsI TTSAA 8 cut(s) 782, 916, 1073, 1229, 1387, 1435, 1444, 1480
AjnI CCWGG 2 cut(s) 323, 610
AjuI GAANNNNNNNTTGG 2 cut(s) 49, 81
AluBI AGCT 8 cut(s) 181, 334, 950, 960, 1061, 1110, 1121, 1277
AluI AGCT 8 cut(s) 181, 334, 950, 960, 1061, 1110, 1121, 1277
Alw26I GTCTC 3 cut(s) 26, 289, 305
AlwI GGATC 7 cut(s) 602, 963, 991, 1601, 1614, 1615, 1620
Aor13HI TCCGGA 1 cut(s) 1609
AoxI GGCC 1 cut(s) 190
ApoI RAATTY 3 cut(s) 880, 1347, 1435
ArsI GACNNNNNNTTYG 1 cut(s) 36
Asp700I GAANNNNTTC 1 cut(s) 728
AspS9I GGNCC 1 cut(s) 301
AsuHPI GGTGA 2 cut(s) 241, 1037
AsuII TTCGAA 1 cut(s) 1565
AvaII GGWCC 1 cut(s) 301
BaeGI GKGCMC 1 cut(s) 142
BamHI GGATCC 1 cut(s) 1606
BccI CCATC 4 cut(s) 369, 457, 970, 974
BcgI CGANNNNNNTGC 2 cut(s) 1443, 1477
BciT130I CCWGG 2 cut(s) 325, 612
BcoDI GTCTC 3 cut(s) 26, 289, 305
BfaI CTAG 6 cut(s) 168, 194, 644, 957, 1062, 1293
BfmI CTRYAG 1 cut(s) 1489
BfrI CTTAAG 2 cut(s) 575, 1105
Bme1390I CCNGG 2 cut(s) 325, 612
Bme18I GGWCC 1 cut(s) 301
BmgT120I GGNCC 1 cut(s) 301
BmiI GGNNCC 1 cut(s) 1608
BmrFI CCNGG 2 cut(s) 325, 612
BmsI GCATC 1 cut(s) 1353
Bpu14I TTCGAA 1 cut(s) 1565
BpuEI CTTGAG 3 cut(s) 254, 350, 1189
BsaBI GATNNNNATC 1 cut(s) 1611
BsaHI GRCGYC 1 cut(s) 246
BsaI GGTCTC 2 cut(s) 26, 305
BsaJI CCNNGG 5 cut(s) 69, 323, 598, 611, 1270
BsaWI WCCGGW 1 cut(s) 1609
BsaXI ACNNNNNCTCC 2 cut(s) 809, 839
Bse8I GATNNNNATC 1 cut(s) 1611
BseAI TCCGGA 1 cut(s) 1609
BseBI CCWGG 2 cut(s) 325, 612
BseDI CCNNGG 5 cut(s) 69, 323, 598, 611, 1270
BseGI GGATG 4 cut(s) 361, 449, 985, 1629
BseJI GATNNNNATC 1 cut(s) 1611
BseSI GKGCMC 1 cut(s) 142
BshFI GGCC 1 cut(s) 192
BsiSI CCGG 1 cut(s) 1610
BsmAI GTCTC 3 cut(s) 26, 289, 305
BsmI GAATGC 1 cut(s) 48
BsnI GGCC 1 cut(s) 192
Bso31I GGTCTC 2 cut(s) 26, 305
Bsp119I TTCGAA 1 cut(s) 1565
Bsp1286I GDGCHC 1 cut(s) 142
Bsp13I TCCGGA 1 cut(s) 1609
Bsp143I GATC 9 cut(s) 43, 607, 924, 968, 983, 1507, 1606, 1612, 1620
Bsp19I CCATGG 1 cut(s) 598
BspANI GGCC 1 cut(s) 192
BspEI TCCGGA 1 cut(s) 1609
BspHI TCATGA 1 cut(s) 24
BspLI GGNNCC 1 cut(s) 1608
BspPI GGATC 7 cut(s) 602, 963, 991, 1601, 1614, 1615, 1620
BspT104I TTCGAA 1 cut(s) 1565
BspTI CTTAAG 2 cut(s) 575, 1105
BspTNI GGTCTC 2 cut(s) 26, 305
BssECI CCNNGG 5 cut(s) 69, 323, 598, 611, 1270
BssMI GATC 9 cut(s) 43, 607, 924, 968, 983, 1507, 1606, 1612, 1620
BssNI GRCGYC 1 cut(s) 246
BssT1I CCWWGG 3 cut(s) 69, 598, 1270
Bst2UI CCWGG 2 cut(s) 325, 612
Bst4CI ACNGT 1 cut(s) 593
BstACI GRCGYC 1 cut(s) 246
BstAFI CTTAAG 2 cut(s) 575, 1105
BstBI TTCGAA 1 cut(s) 1565
BstC8I GCNNGC 2 cut(s) 618, 962
BstDEI CTNAG 1 cut(s) 965
BstDSI CCRYGG 1 cut(s) 598
BstF5I GGATG 4 cut(s) 361, 449, 985, 1629
BstKTI GATC 9 cut(s) 46, 610, 927, 971, 986, 1510, 1609, 1615, 1623
BstMAI GTCTC 3 cut(s) 26, 289, 305
BstMBI GATC 9 cut(s) 43, 607, 924, 968, 983, 1507, 1606, 1612, 1620
BstNI CCWGG 2 cut(s) 325, 612
BstNSI RCATGY 1 cut(s) 99
BstSCI CCNGG 2 cut(s) 323, 610
BstSFI CTRYAG 1 cut(s) 1489
BstSLI GKGCMC 1 cut(s) 142
BstX2I RGATCY 4 cut(s) 968, 983, 1606, 1612
BstYI RGATCY 4 cut(s) 968, 983, 1606, 1612
BsuRI GGCC 1 cut(s) 192
BtgI CCRYGG 1 cut(s) 598
BtsCI GGATG 4 cut(s) 361, 449, 985, 1629
BtsIMutI CAGTG 1 cut(s) 620
Cac8I GCNNGC 2 cut(s) 618, 962
CciI TCATGA 1 cut(s) 24
Cfr13I GGNCC 1 cut(s) 301
CseI GACGC 1 cut(s) 949
Csp6I GTAC 5 cut(s) 636, 648, 706, 1153, 1405
CviAII CATG 7 cut(s) 25, 96, 260, 273, 599, 973, 1322
CviQI GTAC 5 cut(s) 636, 648, 706, 1153, 1405
DdeI CTNAG 1 cut(s) 965
DpnI GATC 9 cut(s) 45, 609, 926, 970, 985, 1509, 1608, 1614, 1622
DpnII GATC 9 cut(s) 43, 607, 924, 968, 983, 1507, 1606, 1612, 1620
DraI TTTAAA 1 cut(s) 879
Eco130I CCWWGG 3 cut(s) 69, 598, 1270
Eco31I GGTCTC 2 cut(s) 26, 305
Eco32I GATATC 2 cut(s) 206, 482
Eco47I GGWCC 1 cut(s) 301
EcoRI GAATTC 1 cut(s) 1435
EcoRII CCWGG 2 cut(s) 323, 610
EcoRV GATATC 2 cut(s) 206, 482
EcoT14I CCWWGG 3 cut(s) 69, 598, 1270
ErhI CCWWGG 3 cut(s) 69, 598, 1270
FaeI CATG 7 cut(s) 28, 99, 263, 276, 602, 976, 1325
FalI AAGNNNNNCTT 4 cut(s) 713, 745, 1394, 1426
FatI CATG 7 cut(s) 24, 95, 259, 272, 598, 972, 1321
FauNDI CATATG 1 cut(s) 123
FokI GGATG 4 cut(s) 348, 436, 992, 1616
FspBI CTAG 6 cut(s) 168, 194, 644, 957, 1062, 1293
HaeIII GGCC 1 cut(s) 192
HapII CCGG 1 cut(s) 1610
HgaI GACGC 1 cut(s) 949
Hin1I GRCGYC 1 cut(s) 246
Hin1II CATG 7 cut(s) 28, 99, 263, 276, 602, 976, 1325
HincII GTYRAC 2 cut(s) 8, 1079
HindII GTYRAC 2 cut(s) 8, 1079
HinfI GANTC 7 cut(s) 28, 263, 319, 581, 696, 1534, 1562
HpaII CCGG 1 cut(s) 1610
HphI GGTGA 2 cut(s) 241, 1037
Hpy166II GTNNAC 3 cut(s) 8, 382, 1079
Hpy188I TCNGA 5 cut(s) 301, 340, 607, 1016, 1465
Hpy188III TCNNGA 5 cut(s) 25, 779, 1262, 1432, 1610
Hpy8I GTNNAC 3 cut(s) 8, 382, 1079
Hpy99I CGWCG 1 cut(s) 248
HpyAV CCTTC 3 cut(s) 1120, 1268, 1591
HpyCH4III ACNGT 1 cut(s) 593
HpyCH4IV ACGT 3 cut(s) 246, 516, 1407
HpyCH4V TGCA 5 cut(s) 165, 407, 620, 1242, 1454
HpyF3I CTNAG 1 cut(s) 965
HpySE526I ACGT 3 cut(s) 246, 516, 1407
Hsp92I GRCGYC 1 cut(s) 246
Hsp92II CATG 7 cut(s) 28, 99, 263, 276, 602, 976, 1325
Kpn2I TCCGGA 1 cut(s) 1609
Kzo9I GATC 9 cut(s) 43, 607, 924, 968, 983, 1507, 1606, 1612, 1620
LmnI GCTCC 2 cut(s) 955, 1274
LpnPI CCDG 6 cut(s) 310, 337, 597, 624, 1247, 1623
LweI GCATC 1 cut(s) 1353
MaeI CTAG 6 cut(s) 168, 194, 644, 957, 1062, 1293
MaeII ACGT 3 cut(s) 246, 516, 1407
MaeIII GTNAC 3 cut(s) 247, 517, 1514
MalI GATC 9 cut(s) 45, 609, 926, 970, 985, 1509, 1608, 1614, 1622
MboI GATC 9 cut(s) 43, 607, 924, 968, 983, 1507, 1606, 1612, 1620
MboII GAAGA 7 cut(s) 44, 476, 733, 1061, 1323, 1502, 1533
MfeI CAATTG 1 cut(s) 920
MflI RGATCY 4 cut(s) 968, 983, 1606, 1612
MhlI GDGCHC 1 cut(s) 142
MlyI GAGTC 2 cut(s) 575, 705
MmeI TCCRAC 3 cut(s) 172, 1326, 1520
MnlI CCTC 3 cut(s) 1230, 1529, 1587
MroI TCCGGA 1 cut(s) 1609
MroXI GAANNNNTTC 1 cut(s) 728
MspCI CTTAAG 2 cut(s) 575, 1105
MspI CCGG 1 cut(s) 1610
MspR9I CCNGG 2 cut(s) 325, 612
MunI CAATTG 1 cut(s) 920
Mva1269I GAATGC 1 cut(s) 48
MvaI CCWGG 2 cut(s) 325, 612
NcoI CCATGG 1 cut(s) 598
NdeI CATATG 1 cut(s) 123
NdeII GATC 9 cut(s) 43, 607, 924, 968, 983, 1507, 1606, 1612, 1620
NlaIII CATG 7 cut(s) 28, 99, 263, 276, 602, 976, 1325
NlaIV GGNNCC 1 cut(s) 1608
NmuCI GTSAC 1 cut(s) 247
NspI RCATGY 1 cut(s) 99
NspV TTCGAA 1 cut(s) 1565
PagI TCATGA 1 cut(s) 24
PciI ACATGT 1 cut(s) 95
PctI GAATGC 1 cut(s) 48
PdmI GAANNNNTTC 1 cut(s) 728
PfeI GAWTC 5 cut(s) 28, 263, 319, 1534, 1562
PleI GAGTC 2 cut(s) 575, 704
PpsI GAGTC 2 cut(s) 575, 704
PscI ACATGT 1 cut(s) 95
Psp6I CCWGG 2 cut(s) 323, 610
PspGI CCWGG 2 cut(s) 323, 610
PspN4I GGNNCC 1 cut(s) 1608
PspPI GGNCC 1 cut(s) 301
PsuI RGATCY 4 cut(s) 968, 983, 1606, 1612
RsaI GTAC 5 cut(s) 637, 649, 707, 1154, 1406
RsaNI GTAC 5 cut(s) 636, 648, 706, 1153, 1405
Sau3AI GATC 9 cut(s) 43, 607, 924, 968, 983, 1507, 1606, 1612, 1620
Sau96I GGNCC 1 cut(s) 301
SchI GAGTC 2 cut(s) 575, 705
ScrFI CCNGG 2 cut(s) 325, 612
SduI GDGCHC 1 cut(s) 142
SfaNI GCATC 1 cut(s) 1353
SfcI CTRYAG 1 cut(s) 1489
SfuI TTCGAA 1 cut(s) 1565
SinI GGWCC 1 cut(s) 301
SmiI ATTTAAAT 1 cut(s) 879
SmlI CTYRAG 5 cut(s) 233, 329, 575, 1105, 1168
SmoI CTYRAG 5 cut(s) 233, 329, 575, 1105, 1168
SspMI CTAG 6 cut(s) 168, 194, 644, 957, 1062, 1293
StyD4I CCNGG 2 cut(s) 323, 610
StyI CCWWGG 3 cut(s) 69, 598, 1270
SwaI ATTTAAAT 1 cut(s) 879
TaaI ACNGT 1 cut(s) 593
TaiI ACGT 3 cut(s) 249, 519, 1410
TaqI TCGA 1 cut(s) 1565
TfiI GAWTC 5 cut(s) 28, 263, 319, 1534, 1562
TscAI CASTG 1 cut(s) 627
TseFI GTSAC 1 cut(s) 247
Tsp45I GTSAC 1 cut(s) 247
TspDTI ATGAA 9 cut(s) 41, 334, 366, 476, 1122, 1202, 1310, 1316, 1340
TspRI CASTG 1 cut(s) 627
Vha464I CTTAAG 2 cut(s) 575, 1105
VpaK11BI GGWCC 1 cut(s) 301
XapI RAATTY 3 cut(s) 880, 1347, 1435
XceI RCATGY 1 cut(s) 99
XmnI GAANNNNTTC 1 cut(s) 728
XspI CTAG 6 cut(s) 168, 194, 644, 957, 1062, 1293
ZraI GACGTC 1 cut(s) 247
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.