pycom01g00130

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
OG0000158
Physical Location & Seq
Forward (+)
319138 .. 319859
722 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g00130.2

Sequence Viewer

Length: 543 bp
ATGAAGGTGTGGCAAAGCGGACAATATCGTGCTACGGCGGAGTCAAGATTGGGATGTGACAGAATGGTATCAGAACCACTCTGCCGTGTGCCCACTTCGACCAATGGAGAGGGGGTGATGTGCCTTATATGTACATACCCACCTCCATATAGCATGAGGCCTTTTGGGAACTCATTGGCTTCGGATTCCATCGGAACTCTGAAGTTAAGTGAGTTTGAGCGAGTGCATTCTCAGAAACAAAGCCGTGAGGGCGTGGCCGGTGTACAAAGCGGACAATATCATGCTATGGCGGAGTTGAGACTGGAATGTGACAGCGTAGCTAGAGCCCTTAGATTTCTTTATTGGTTGACCCCGTTGCCTCAGATTTTAATTCTTGTTTCCAAATCAACTAAACATGTTTTCTCTTGCACAAGAAAAGAAAGTGGTTTAAGCGATGTATACCTAAAAATAGATGGTTGTAATGACGCCTACCACTATTGTGCCCTGATTGTGGCTTCTTGTTGCCAAACTTTGGTTCTTTGCCATGGGGTGTATTCATGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

181

Amino Acids

20.06

Weight (kDa)

8.28

Isoelectric Point (pI)

50.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 511
AccI GTMKAC 1 cut(s) 438
AciI CCGC 4 cut(s) 18, 38, 270, 290
AcoI YGGCCR 1 cut(s) 255
AcuI CTGAAG 1 cut(s) 221
AcyI GRCGYC 1 cut(s) 465
AfaI GTAC 2 cut(s) 133, 264
AfiI CCNNNNNNNGG 2 cut(s) 490, 511
AflIII ACRYGT 1 cut(s) 394
AjuI GAANNNNNNNTTGG 2 cut(s) 498, 530
AleI CACNNNNGTG 1 cut(s) 477
AluBI AGCT 1 cut(s) 320
AluI AGCT 1 cut(s) 320
Alw26I GTCTC 1 cut(s) 292
AoxI GGCC 2 cut(s) 158, 255
AsuHPI GGTGA 1 cut(s) 127
BaeGI GKGCMC 2 cut(s) 93, 484
BanII GRGCYC 1 cut(s) 328
BccI CCATC 2 cut(s) 197, 446
BceAI ACGGC 3 cut(s) 51, 69, 228
BcoDI GTCTC 1 cut(s) 292
BfaI CTAG 1 cut(s) 321
BglI GCCNNNNNGGC 1 cut(s) 249
BsaHI GRCGYC 1 cut(s) 465
BsaJI CCNNGG 1 cut(s) 523
BsaXI ACNNNNNCTCC 2 cut(s) 99, 129
Bsc4I CCNNNNNNNGG 2 cut(s) 490, 511
Bse118I RCCGGY 1 cut(s) 257
Bse1I ACTGG 1 cut(s) 306
BseDI CCNNGG 1 cut(s) 523
BseGI GGATG 1 cut(s) 59
BseLI CCNNNNNNNGG 2 cut(s) 490, 511
BseMII CTCAG 2 cut(s) 245, 374
BseNI ACTGG 1 cut(s) 306
BseSI GKGCMC 2 cut(s) 93, 484
BshFI GGCC 2 cut(s) 160, 257
BsiSI CCGG 1 cut(s) 258
BslI CCNNNNNNNGG 2 cut(s) 490, 511
BsmAI GTCTC 1 cut(s) 292
BsmI GAATGC 1 cut(s) 226
BsnI GGCC 2 cut(s) 160, 257
Bsp1286I GDGCHC 3 cut(s) 93, 328, 484
Bsp1407I TGTACA 2 cut(s) 131, 262
Bsp19I CCATGG 1 cut(s) 523
BspACI CCGC 4 cut(s) 18, 38, 270, 290
BspANI GGCC 2 cut(s) 160, 257
BspCNI CTCAG 2 cut(s) 244, 373
BsrFI RCCGGY 1 cut(s) 257
BsrGI TGTACA 2 cut(s) 131, 262
BsrI ACTGG 1 cut(s) 306
BssAI RCCGGY 1 cut(s) 257
BssECI CCNNGG 1 cut(s) 523
BssNAI GTATAC 1 cut(s) 439
BssNI GRCGYC 1 cut(s) 465
BssT1I CCWWGG 1 cut(s) 523
Bst1107I GTATAC 1 cut(s) 439
BstACI GRCGYC 1 cut(s) 465
BstAUI TGTACA 2 cut(s) 131, 262
BstDEI CTNAG 3 cut(s) 231, 329, 360
BstDSI CCRYGG 1 cut(s) 523
BstF5I GGATG 1 cut(s) 59
BstMAI GTCTC 1 cut(s) 292
BstMWI GCNNNNNNNGC 1 cut(s) 249
BstNSI RCATGY 1 cut(s) 398
BstSLI GKGCMC 2 cut(s) 93, 484
BstZ17I GTATAC 1 cut(s) 439
BsuRI GGCC 2 cut(s) 160, 257
BtgI CCRYGG 1 cut(s) 523
BtgZI GCGATG 1 cut(s) 447
BtsCI GGATG 1 cut(s) 59
Cfr10I RCCGGY 1 cut(s) 257
CseI GACGC 1 cut(s) 473
Csp6I GTAC 2 cut(s) 132, 263
CviAII CATG 5 cut(s) 154, 281, 395, 524, 537
CviJI RGCY 7 cut(s) 160, 179, 243, 257, 320, 326, 494
CviKI_1 RGCY 7 cut(s) 160, 179, 243, 257, 320, 326, 494
CviQI GTAC 2 cut(s) 132, 263
DdeI CTNAG 3 cut(s) 231, 329, 360
EaeI YGGCCR 1 cut(s) 255
EciI GGCGGA 2 cut(s) 53, 305
Eco130I CCWWGG 1 cut(s) 523
Eco147I AGGCCT 1 cut(s) 160
Eco24I GRGCYC 1 cut(s) 328
Eco57I CTGAAG 1 cut(s) 221
EcoT14I CCWWGG 1 cut(s) 523
EcoT38I GRGCYC 1 cut(s) 328
ErhI CCWWGG 1 cut(s) 523
FaeI CATG 5 cut(s) 157, 284, 398, 527, 540
FatI CATG 5 cut(s) 153, 280, 394, 523, 536
FblI GTMKAC 1 cut(s) 438
FokI GGATG 1 cut(s) 66
FriOI GRGCYC 1 cut(s) 328
FspBI CTAG 1 cut(s) 321
HaeIII GGCC 2 cut(s) 160, 257
HapII CCGG 1 cut(s) 258
HgaI GACGC 1 cut(s) 473
Hin1I GRCGYC 1 cut(s) 465
Hin1II CATG 5 cut(s) 157, 284, 398, 527, 540
HincII GTYRAC 1 cut(s) 348
HindII GTYRAC 1 cut(s) 348
HinfI GANTC 2 cut(s) 41, 185
HpaII CCGG 1 cut(s) 258
HphI GGTGA 1 cut(s) 127
Hpy166II GTNNAC 3 cut(s) 263, 348, 439
Hpy188I TCNGA 6 cut(s) 73, 184, 194, 201, 234, 363
Hpy188III TCNNGA 1 cut(s) 45
Hpy8I GTNNAC 3 cut(s) 263, 348, 439
HpyCH4V TGCA 2 cut(s) 226, 408
HpyF10VI GCNNNNNNNGC 1 cut(s) 249
HpyF3I CTNAG 3 cut(s) 231, 329, 360
Hsp92I GRCGYC 1 cut(s) 465
Hsp92II CATG 5 cut(s) 157, 284, 398, 527, 540
LpnPI CCDG 3 cut(s) 271, 287, 497
MaeI CTAG 1 cut(s) 321
MaeIII GTNAC 2 cut(s) 56, 308
MhlI GDGCHC 3 cut(s) 93, 328, 484
MluCI AATT 1 cut(s) 369
MlyI GAGTC 1 cut(s) 50
MnlI CCTC 5 cut(s) 103, 150, 153, 241, 369
MseI TTAA 3 cut(s) 206, 368, 428
MslI CAYNNNNRTG 1 cut(s) 477
MspI CCGG 1 cut(s) 258
Mva1269I GAATGC 1 cut(s) 226
MwoI GCNNNNNNNGC 1 cut(s) 249
NcoI CCATGG 1 cut(s) 523
NlaIII CATG 5 cut(s) 157, 284, 398, 527, 540
NmuCI GTSAC 2 cut(s) 56, 308
NspI RCATGY 1 cut(s) 398
OliI CACNNNNGTG 1 cut(s) 477
PceI AGGCCT 1 cut(s) 160
PciI ACATGT 1 cut(s) 394
PctI GAATGC 1 cut(s) 226
PfeI GAWTC 1 cut(s) 185
PflMI CCANNNNNTGG 1 cut(s) 511
PleI GAGTC 1 cut(s) 49
PpsI GAGTC 1 cut(s) 49
PscI ACATGT 1 cut(s) 394
RsaI GTAC 2 cut(s) 133, 264
RsaNI GTAC 2 cut(s) 132, 263
RseI CAYNNNNRTG 1 cut(s) 477
SaqAI TTAA 3 cut(s) 206, 368, 428
SchI GAGTC 1 cut(s) 50
SduI GDGCHC 3 cut(s) 93, 328, 484
SetI ASST 4 cut(s) 9, 145, 322, 444
SmiMI CAYNNNNRTG 1 cut(s) 477
Sse9I AATT 1 cut(s) 369
SseBI AGGCCT 1 cut(s) 160
SsiI CCGC 4 cut(s) 18, 38, 270, 290
SspMI CTAG 1 cut(s) 321
StuI AGGCCT 1 cut(s) 160
StyI CCWWGG 1 cut(s) 523
TaqI TCGA 1 cut(s) 98
TasI AATT 1 cut(s) 369
TatI WGTACW 2 cut(s) 131, 262
TfiI GAWTC 1 cut(s) 185
Tru1I TTAA 3 cut(s) 206, 368, 428
Tru9I TTAA 3 cut(s) 206, 368, 428
TseFI GTSAC 2 cut(s) 56, 308
Tsp45I GTSAC 2 cut(s) 56, 308
TspDTI ATGAA 2 cut(s) 17, 525
Van91I CCANNNNNTGG 1 cut(s) 511
XceI RCATGY 1 cut(s) 398
XmiI GTMKAC 1 cut(s) 438
XspI CTAG 1 cut(s) 321
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.