pycom13g27940

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
OG0000158
Physical Location & Seq
Forward (+)
23995555 .. 23996939
1385 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom13g27940.4

Sequence Viewer

Length: 909 bp
ATGATGGGTGACCCACTGGGAAGTTCTCATGTGAGTTCCCAAAAACAAAACCGTGAGGGTGTAATAGGGGCCCAAAGCCGACAATATCGTGCTACGGTGGAGTCAGGCCGGGGTTTGGTAGGGGCCCGGCCTATGCATTTTTACCAATTACTTACGATCTACACATGCCACCTTGAAGAACGTATATCTGACATGCAATCCGTCCGAATGTTCGGATCAAACATGAACATGAGAGACTCATTATACATGGTGTTCATCTTAAGTGAAATTACAATTATTAATCACAAGAAGCCAGCGCCAATTTTAGGGAACCTTCCGACCAAAATTGCATCAAATTACTTTTCTAAAGATCCTAATGTAAAAATTCAAAGCAAACATGCAATCAATCATAAGCAATTAAATAAAAATTACATATTCATGCTAAGGCCAAGGCTTTGCCCTAGCAAAAGGAATTACTCCAAGAACCCTAGCAATTCTCTTTGTCTCCAAAGTTGCATAAAAGAAAGCGTAGAAAAGACTAAGAATGGGAAAAGCAATATATTTGATAAGCCATCCTTAGAAAATAAAGCCCTAATTAAACTAGGAGAATCTGCCAAGTACTTGTCCAACCACGTTTTAGCCTCAAATCTCCTCCAAATCCGGCCCAAAATAAAGGCCACAAACCCATCTGAGGTCATCTTGGGCTCCGAAAATGCCATTCAAGCCCAAAACGTCACTCTTCCAACACTGCGCATTGCTCCTTTATTTTATTGCCAGAAAATGATCAATTACTCCAAAATTCGTCCATTTGATTATGTTTTGCTCCAAATGAAATCAAAAACTAAGAATAGGGTTAAATATCACGTGAAGGACTGTGCCCTGGCCACGAATGGGAGCACTAACACTGGGGTGCAGGATAATGAGCACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

303

Amino Acids

34.13

Weight (kDa)

9.85

Isoelectric Point (pI)

48.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 731
AclWI GGATC 2 cut(s) 223, 344
AcoI YGGCCR 1 cut(s) 861
AcsI RAATTY 2 cut(s) 363, 777
AcvI CACGTG 1 cut(s) 844
AfaI GTAC 1 cut(s) 599
AfiI CCNNNNNNNGG 4 cut(s) 115, 305, 670, 870
AflII CTTAAG 1 cut(s) 259
AgsI TTSAA 3 cut(s) 176, 368, 701
AjnI CCWGG 1 cut(s) 858
AleI CACNNNNGTG 1 cut(s) 887
Alw21I GWGCWC 2 cut(s) 878, 906
Alw26I GTCTC 2 cut(s) 228, 488
AlwI GGATC 2 cut(s) 223, 344
AoxI GGCC 8 cut(s) 69, 106, 123, 128, 425, 641, 654, 861
ApaI GGGCCC 2 cut(s) 73, 127
ApoI RAATTY 2 cut(s) 363, 777
AseI ATTAAT 1 cut(s) 279
AspLEI GCGC 2 cut(s) 298, 732
AspS9I GGNCC 5 cut(s) 69, 70, 123, 124, 642
AsuC2I CCSGG 2 cut(s) 110, 127
AsuHPI GGTGA 1 cut(s) 20
BaeGI GKGCMC 3 cut(s) 73, 127, 859
BalI TGGCCA 1 cut(s) 863
BanII GRGCYC 3 cut(s) 73, 127, 686
BbrPI CACGTG 1 cut(s) 844
Bbv12I GWGCWC 2 cut(s) 878, 906
BccI CCATC 2 cut(s) 559, 673
BciT130I CCWGG 1 cut(s) 860
BclI TGATCA 1 cut(s) 762
BcnI CCSGG 2 cut(s) 110, 127
BcoDI GTCTC 2 cut(s) 228, 488
BfaI CTAG 3 cut(s) 441, 468, 581
BfoI RGCGCY 1 cut(s) 299
BfrI CTTAAG 1 cut(s) 259
BmcAI AGTACT 1 cut(s) 599
Bme1390I CCNGG 3 cut(s) 110, 127, 860
BmgT120I GGNCC 5 cut(s) 69, 70, 123, 124, 642
BmiI GGNNCC 6 cut(s) 70, 71, 124, 125, 311, 685
BmrFI CCNGG 3 cut(s) 110, 127, 860
BmrI ACTGGG 2 cut(s) 26, 894
BmsI GCATC 1 cut(s) 338
BmuI ACTGGG 2 cut(s) 26, 894
Bpu10I CCTNAGC 1 cut(s) 422
BpuMI CCSGG 2 cut(s) 110, 127
BsaAI YACGTR 1 cut(s) 844
BsaJI CCNNGG 3 cut(s) 109, 428, 858
Bsc4I CCNNNNNNNGG 4 cut(s) 115, 305, 670, 870
Bse1I ACTGG 2 cut(s) 21, 889
Bse3DI GCAATG 1 cut(s) 732
BseBI CCWGG 1 cut(s) 860
BseDI CCNNGG 3 cut(s) 109, 428, 858
BseGI GGATG 1 cut(s) 551
BseLI CCNNNNNNNGG 4 cut(s) 115, 305, 670, 870
BseMI GCAATG 1 cut(s) 732
BseMII CTCAG 1 cut(s) 660
BseNI ACTGG 2 cut(s) 21, 889
BseRI GAGGAG 1 cut(s) 620
BseSI GKGCMC 3 cut(s) 73, 127, 859
BshFI GGCC 8 cut(s) 71, 108, 125, 130, 427, 643, 656, 863
BsiHKAI GWGCWC 2 cut(s) 878, 906
BsiSI CCGG 3 cut(s) 109, 127, 640
BslI CCNNNNNNNGG 4 cut(s) 115, 305, 670, 870
BsmAI GTCTC 2 cut(s) 228, 488
BsnI GGCC 8 cut(s) 71, 108, 125, 130, 427, 643, 656, 863
Bsp120I GGGCCC 2 cut(s) 69, 123
Bsp1286I GDGCHC 6 cut(s) 73, 127, 686, 859, 878, 906
Bsp143I GATC 4 cut(s) 156, 215, 349, 762
BspANI GGCC 8 cut(s) 71, 108, 125, 130, 427, 643, 656, 863
BspCNI CTCAG 1 cut(s) 661
BspLI GGNNCC 6 cut(s) 70, 71, 124, 125, 311, 685
BspPI GGATC 2 cut(s) 223, 344
BspTI CTTAAG 1 cut(s) 259
BsrDI GCAATG 1 cut(s) 732
BsrI ACTGG 2 cut(s) 21, 889
BssECI CCNNGG 3 cut(s) 109, 428, 858
BssMI GATC 4 cut(s) 156, 215, 349, 762
BssT1I CCWWGG 1 cut(s) 428
Bst2UI CCWGG 1 cut(s) 860
Bst4CI ACNGT 3 cut(s) 53, 97, 854
Bst6I CTCTTC 1 cut(s) 723
BstAFI CTTAAG 1 cut(s) 259
BstBAI YACGTR 1 cut(s) 844
BstC8I GCNNGC 1 cut(s) 294
BstDEI CTNAG 5 cut(s) 422, 519, 556, 669, 822
BstEII GGTNACC 1 cut(s) 8
BstF5I GGATG 1 cut(s) 551
BstH2I RGCGCY 1 cut(s) 299
BstHHI GCGC 2 cut(s) 298, 732
BstKTI GATC 4 cut(s) 159, 218, 352, 765
BstMAI GTCTC 2 cut(s) 228, 488
BstMBI GATC 4 cut(s) 156, 215, 349, 762
BstMWI GCNNNNNNNGC 1 cut(s) 701
BstNI CCWGG 1 cut(s) 860
BstNSI RCATGY 3 cut(s) 168, 196, 380
BstPI GGTNACC 1 cut(s) 8
BstSCI CCNGG 3 cut(s) 108, 125, 858
BstSLI GKGCMC 3 cut(s) 73, 127, 859
BstX2I RGATCY 1 cut(s) 349
BstYI RGATCY 1 cut(s) 349
BsuRI GGCC 8 cut(s) 71, 108, 125, 130, 427, 643, 656, 863
BtsCI GGATG 1 cut(s) 551
BtsI GCAGTG 1 cut(s) 725
BtsIMutI CAGTG 4 cut(s) 14, 725, 882, 904
Cac8I GCNNGC 1 cut(s) 294
CfoI GCGC 2 cut(s) 298, 732
Cfr13I GGNCC 5 cut(s) 69, 70, 123, 124, 642
Csp6I GTAC 1 cut(s) 598
CviAII CATG 8 cut(s) 29, 165, 193, 223, 229, 247, 377, 418
CviQI GTAC 1 cut(s) 598
DdeI CTNAG 5 cut(s) 422, 519, 556, 669, 822
DpnI GATC 4 cut(s) 158, 217, 351, 764
DpnII GATC 4 cut(s) 156, 215, 349, 762
EaeI YGGCCR 1 cut(s) 861
Eam1104I CTCTTC 1 cut(s) 723
EarI CTCTTC 1 cut(s) 723
Eco130I CCWWGG 1 cut(s) 428
Eco24I GRGCYC 3 cut(s) 73, 127, 686
Eco72I CACGTG 1 cut(s) 844
Eco91I GGTNACC 1 cut(s) 8
EcoO109I RGGNCCY 2 cut(s) 69, 123
EcoO65I GGTNACC 1 cut(s) 8
EcoRII CCWGG 1 cut(s) 858
EcoT14I CCWWGG 1 cut(s) 428
EcoT22I ATGCAT 1 cut(s) 138
EcoT38I GRGCYC 3 cut(s) 73, 127, 686
ErhI CCWWGG 1 cut(s) 428
FaeI CATG 8 cut(s) 32, 168, 196, 226, 232, 250, 380, 421
FalI AAGNNNNNCTT 2 cut(s) 539, 571
FatI CATG 8 cut(s) 28, 164, 192, 222, 228, 246, 376, 417
FbaI TGATCA 1 cut(s) 762
FokI GGATG 1 cut(s) 538
FriOI GRGCYC 3 cut(s) 73, 127, 686
FspBI CTAG 3 cut(s) 441, 468, 581
FspI TGCGCA 1 cut(s) 731
GlaI GCGC 2 cut(s) 297, 731
HaeII RGCGCY 1 cut(s) 299
HaeIII GGCC 8 cut(s) 71, 108, 125, 130, 427, 643, 656, 863
HapII CCGG 3 cut(s) 109, 127, 640
HhaI GCGC 2 cut(s) 298, 732
Hin1II CATG 8 cut(s) 32, 168, 196, 226, 232, 250, 380, 421
Hin6I GCGC 2 cut(s) 296, 730
HinP1I GCGC 2 cut(s) 296, 730
HinfI GANTC 3 cut(s) 101, 236, 587
HpaII CCGG 3 cut(s) 109, 127, 640
HphI GGTGA 1 cut(s) 20
Hpy188I TCNGA 6 cut(s) 190, 206, 215, 318, 670, 688
HpyAV CCTTC 2 cut(s) 323, 841
HpyCH4III ACNGT 3 cut(s) 53, 97, 854
HpyCH4IV ACGT 4 cut(s) 181, 612, 711, 843
HpyCH4V TGCA 6 cut(s) 136, 196, 329, 380, 495, 892
HpyF10VI GCNNNNNNNGC 1 cut(s) 701
HpyF3I CTNAG 5 cut(s) 422, 519, 556, 669, 822
HpySE526I ACGT 4 cut(s) 181, 612, 711, 843
Hsp92II CATG 8 cut(s) 32, 168, 196, 226, 232, 250, 380, 421
HspAI GCGC 2 cut(s) 296, 730
Ksp22I TGATCA 1 cut(s) 762
Kzo9I GATC 4 cut(s) 156, 215, 349, 762
LmnI GCTCC 4 cut(s) 689, 742, 807, 873
LweI GCATC 1 cut(s) 338
MaeI CTAG 3 cut(s) 441, 468, 581
MaeII ACGT 4 cut(s) 181, 612, 711, 843
MaeIII GTNAC 2 cut(s) 8, 712
MalI GATC 4 cut(s) 158, 217, 351, 764
MboI GATC 4 cut(s) 156, 215, 349, 762
MboII GAAGA 2 cut(s) 188, 710
MflI RGATCY 1 cut(s) 349
MhlI GDGCHC 6 cut(s) 73, 127, 686, 859, 878, 906
MlsI TGGCCA 1 cut(s) 863
MluNI TGGCCA 1 cut(s) 863
MlyI GAGTC 2 cut(s) 110, 230
MmeI TCCRAC 3 cut(s) 341, 630, 746
MnlI CCTC 4 cut(s) 49, 631, 641, 664
Mox20I TGGCCA 1 cut(s) 863
Mph1103I ATGCAT 1 cut(s) 138
MscI TGGCCA 1 cut(s) 863
MseI TTAA 5 cut(s) 260, 279, 398, 576, 834
MslI CAYNNNNRTG 3 cut(s) 227, 416, 887
Msp20I TGGCCA 1 cut(s) 863
MspCI CTTAAG 1 cut(s) 259
MspI CCGG 3 cut(s) 109, 127, 640
MspR9I CCNGG 3 cut(s) 110, 127, 860
MvaI CCWGG 1 cut(s) 860
MwoI GCNNNNNNNGC 1 cut(s) 701
NciI CCSGG 2 cut(s) 110, 127
NdeII GATC 4 cut(s) 156, 215, 349, 762
NlaIII CATG 8 cut(s) 32, 168, 196, 226, 232, 250, 380, 421
NlaIV GGNNCC 6 cut(s) 70, 71, 124, 125, 311, 685
NmuCI GTSAC 2 cut(s) 8, 712
NsbI TGCGCA 1 cut(s) 731
NsiI ATGCAT 1 cut(s) 138
NspI RCATGY 3 cut(s) 168, 196, 380
OliI CACNNNNGTG 1 cut(s) 887
PfeI GAWTC 1 cut(s) 587
PleI GAGTC 2 cut(s) 109, 230
PmaCI CACGTG 1 cut(s) 844
PmlI CACGTG 1 cut(s) 844
PpsI GAGTC 2 cut(s) 109, 230
Ppu21I YACGTR 1 cut(s) 844
PshBI ATTAAT 1 cut(s) 279
Psp6I CCWGG 1 cut(s) 858
PspCI CACGTG 1 cut(s) 844
PspEI GGTNACC 1 cut(s) 8
PspGI CCWGG 1 cut(s) 858
PspN4I GGNNCC 6 cut(s) 70, 71, 124, 125, 311, 685
PspOMI GGGCCC 2 cut(s) 69, 123
PspPI GGNCC 5 cut(s) 69, 70, 123, 124, 642
PsuI RGATCY 1 cut(s) 349
RsaI GTAC 1 cut(s) 599
RsaNI GTAC 1 cut(s) 598
RseI CAYNNNNRTG 3 cut(s) 227, 416, 887
SaqAI TTAA 5 cut(s) 260, 279, 398, 576, 834
Sau3AI GATC 4 cut(s) 156, 215, 349, 762
Sau96I GGNCC 5 cut(s) 69, 70, 123, 124, 642
ScaI AGTACT 1 cut(s) 599
SchI GAGTC 2 cut(s) 110, 230
ScrFI CCNGG 3 cut(s) 110, 127, 860
SduI GDGCHC 6 cut(s) 73, 127, 686, 859, 878, 906
SetI ASST 7 cut(s) 174, 184, 315, 615, 675, 714, 846
SfaNI GCATC 1 cut(s) 338
SmiMI CAYNNNNRTG 3 cut(s) 227, 416, 887
SmlI CTYRAG 1 cut(s) 259
SmoI CTYRAG 1 cut(s) 259
SspMI CTAG 3 cut(s) 441, 468, 581
StyD4I CCNGG 3 cut(s) 108, 125, 858
StyI CCWWGG 1 cut(s) 428
TaaI ACNGT 3 cut(s) 53, 97, 854
TaiI ACGT 4 cut(s) 184, 615, 714, 846
TatI WGTACW 1 cut(s) 597
TfiI GAWTC 1 cut(s) 587
Tru1I TTAA 5 cut(s) 260, 279, 398, 576, 834
Tru9I TTAA 5 cut(s) 260, 279, 398, 576, 834
TscAI CASTG 3 cut(s) 21, 732, 889
TseFI GTSAC 2 cut(s) 8, 712
Tsp45I GTSAC 2 cut(s) 8, 712
TspDTI ATGAA 4 cut(s) 239, 244, 406, 824
TspGWI ACGGA 1 cut(s) 190
TspRI CASTG 3 cut(s) 21, 732, 889
Vha464I CTTAAG 1 cut(s) 259
VspI ATTAAT 1 cut(s) 279
XapI RAATTY 2 cut(s) 363, 777
XceI RCATGY 3 cut(s) 168, 196, 380
XspI CTAG 3 cut(s) 441, 468, 581
ZrmI AGTACT 1 cut(s) 599
Zsp2I ATGCAT 1 cut(s) 138
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.