pycom11g14400

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
OG0000158
Physical Location & Seq
Forward (+)
14325640 .. 14326776
1137 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom11g14400.4

Sequence Viewer

Length: 855 bp
ATGTGTCCCTTTTGTCTAAGGTTGAATTCCTCTTCCTGTAGATTTGTCCTAGTTGATAAAATTCCTTGTACGTTAGAGTATAAATTTGTAGATCAAATTAGCAAACCAAATATGTGTCACCAACAAGAAATGAGCACGTGTAGCATTCCACATTGCCCAGGGGAGTGGATCCTCTATGCCTTATATCTCACTGGCTTTGGATTCCGTTGGAACTCCGAAGTTAAGCGAGTACTGTGCGAGAGCAATCCCATGATGGGTGACTCAGTGGGAAGTTCTCGTGTGAGTTCCCAGAAACAAAACCGTGAGGGCGTGGTTGGGGCCCAAAGCGAACAATATCGTGCTACGGTGGAGTCGAACCTGAGATGTGGTGGGGACCTAGTTTTTTTGTCAACACTTAAAAAATTTAATCTGGTTTTCTATGAGGTCATTGTCATGAGCAGCATATCGCATCTAGTTTTAAAGATGTTTCTTCTTTTTATCCCTTATGTTTTGGAATTAATAGTTCCAAATTTGCACATTACATTATTTCTTTTGTATTTTTTTTATACTTATTTGCGTTTCGTTCTGAGTCACGATACATCAAGTTCATTGTTTCAATTCATAAACATAACTTTAGAGGTTTCATTCATAACAGAACTTAGGAATTCCAACTTAAACTTCATCTTAACAGTTGTTATAGGTCATTCATTTGTTTCTATTTCTTTTAAAGGATTCAATCATTATCTTAGGGTGTTTGTAATTTTTCGCTTATATTTCTATCTGTTTGGAGGGCACATGAATTTTTTAGAGTGCCTTAACAGCTTCCTTATTTTATTGTTAGCAAGGATTCATTACCAACTTTTGTTAGATAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

285

Amino Acids

32.94

Weight (kDa)

8.3

Isoelectric Point (pI)

48.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 163, 176
AcsI RAATTY 7 cut(s) 25, 60, 83, 401, 508, 643, 778
AcvI CACGTG 1 cut(s) 138
AfaI GTAC 2 cut(s) 70, 231
AfiI CCNNNNNNNGG 1 cut(s) 254
AflIII ACRYGT 1 cut(s) 137
AgsI TTSAA 3 cut(s) 25, 596, 715
AjnI CCWGG 1 cut(s) 157
AjuI GAANNNNNNNTTGG 2 cut(s) 641, 673
AluBI AGCT 1 cut(s) 801
AluI AGCT 1 cut(s) 801
Alw21I GWGCWC 1 cut(s) 137
AlwI GGATC 2 cut(s) 163, 176
AoxI GGCC 1 cut(s) 318
ApaI GGGCCC 1 cut(s) 322
ApeKI GCWGC 1 cut(s) 438
ApoI RAATTY 7 cut(s) 25, 60, 83, 401, 508, 643, 778
AseI ATTAAT 1 cut(s) 497
AspS9I GGNCC 3 cut(s) 318, 319, 373
AsuHPI GGTGA 2 cut(s) 110, 269
AvaII GGWCC 1 cut(s) 373
BaeGI GKGCMC 2 cut(s) 322, 774
BamHI GGATCC 1 cut(s) 168
BanII GRGCYC 1 cut(s) 322
BauI CACGAG 1 cut(s) 276
BbrPI CACGTG 1 cut(s) 138
Bbv12I GWGCWC 1 cut(s) 137
BbvI GCAGC 1 cut(s) 450
BccI CCATC 1 cut(s) 247
BcgI CGANNNNNNTGC 2 cut(s) 216, 250
BciT130I CCWGG 1 cut(s) 159
BfaI CTAG 3 cut(s) 50, 377, 452
BfmI CTRYAG 1 cut(s) 37
BisI GCNGC 1 cut(s) 439
BlsI GCNGC 1 cut(s) 440
BmcAI AGTACT 1 cut(s) 231
Bme1390I CCNGG 1 cut(s) 159
Bme18I GGWCC 1 cut(s) 373
BmgT120I GGNCC 3 cut(s) 318, 319, 373
BmiI GGNNCC 4 cut(s) 170, 319, 320, 374
BmrFI CCNGG 1 cut(s) 159
BmsI GCATC 1 cut(s) 457
BsaAI YACGTR 1 cut(s) 138
BsaJI CCNNGG 2 cut(s) 157, 158
Bsc4I CCNNNNNNNGG 1 cut(s) 254
Bse1I ACTGG 1 cut(s) 196
Bse3DI GCAATG 1 cut(s) 151
BseBI CCWGG 1 cut(s) 159
BseDI CCNNGG 2 cut(s) 157, 158
BseLI CCNNNNNNNGG 1 cut(s) 254
BseMI GCAATG 1 cut(s) 151
BseMII CTCAG 3 cut(s) 276, 350, 557
BseNI ACTGG 1 cut(s) 196
BseSI GKGCMC 2 cut(s) 322, 774
BseXI GCAGC 1 cut(s) 450
BshFI GGCC 1 cut(s) 320
BsiHKAI GWGCWC 1 cut(s) 137
BslFI GGGAC 1 cut(s) 386
BslI CCNNNNNNNGG 1 cut(s) 254
BsmFI GGGAC 1 cut(s) 386
BsmI GAATGC 1 cut(s) 144
BsnI GGCC 1 cut(s) 320
Bsp120I GGGCCC 1 cut(s) 318
Bsp1286I GDGCHC 3 cut(s) 137, 322, 774
Bsp143I GATC 2 cut(s) 91, 168
BspANI GGCC 1 cut(s) 320
BspCNI CTCAG 3 cut(s) 275, 351, 558
BspHI TCATGA 1 cut(s) 432
BspLI GGNNCC 4 cut(s) 170, 319, 320, 374
BspPI GGATC 2 cut(s) 163, 176
BsrDI GCAATG 1 cut(s) 151
BsrI ACTGG 1 cut(s) 196
BssECI CCNNGG 2 cut(s) 157, 158
BssMI GATC 2 cut(s) 91, 168
BssSI CACGAG 1 cut(s) 276
Bst2BI CACGAG 1 cut(s) 276
Bst2UI CCWGG 1 cut(s) 159
Bst4CI ACNGT 4 cut(s) 234, 302, 346, 670
Bst6I CTCTTC 1 cut(s) 37
BstBAI YACGTR 1 cut(s) 138
BstDEI CTNAG 6 cut(s) 17, 262, 359, 566, 638, 725
BstKTI GATC 2 cut(s) 94, 171
BstMBI GATC 2 cut(s) 91, 168
BstMWI GCNNNNNNNGC 2 cut(s) 141, 798
BstNI CCWGG 1 cut(s) 159
BstSCI CCNGG 1 cut(s) 157
BstSFI CTRYAG 1 cut(s) 37
BstSLI GKGCMC 2 cut(s) 322, 774
BstV1I GCAGC 1 cut(s) 450
BstX2I RGATCY 1 cut(s) 168
BstXI CCANNNNNNTGG 1 cut(s) 165
BstYI RGATCY 1 cut(s) 168
BsuRI GGCC 1 cut(s) 320
BtsIMutI CAGTG 2 cut(s) 189, 270
CciI TCATGA 1 cut(s) 432
Cfr13I GGNCC 3 cut(s) 318, 319, 373
Csp6I GTAC 2 cut(s) 69, 230
CviAII CATG 3 cut(s) 250, 433, 775
CviJI RGCY 3 cut(s) 195, 320, 801
CviKI_1 RGCY 3 cut(s) 195, 320, 801
CviQI GTAC 2 cut(s) 69, 230
DdeI CTNAG 6 cut(s) 17, 262, 359, 566, 638, 725
DpnI GATC 2 cut(s) 93, 170
DpnII GATC 2 cut(s) 91, 168
DraI TTTAAA 2 cut(s) 459, 706
Eam1104I CTCTTC 1 cut(s) 37
EarI CTCTTC 1 cut(s) 37
Eco24I GRGCYC 1 cut(s) 322
Eco47I GGWCC 1 cut(s) 373
Eco72I CACGTG 1 cut(s) 138
EcoO109I RGGNCCY 2 cut(s) 318, 373
EcoRI GAATTC 2 cut(s) 25, 643
EcoRII CCWGG 1 cut(s) 157
EcoT38I GRGCYC 1 cut(s) 322
FaeI CATG 3 cut(s) 253, 436, 778
FaqI GGGAC 1 cut(s) 386
FatI CATG 3 cut(s) 249, 432, 774
Fnu4HI GCNGC 1 cut(s) 439
FriOI GRGCYC 1 cut(s) 322
Fsp4HI GCNGC 1 cut(s) 439
FspBI CTAG 3 cut(s) 50, 377, 452
GluI GCNGC 1 cut(s) 439
HaeIII GGCC 1 cut(s) 320
Hin1II CATG 3 cut(s) 253, 436, 778
HincII GTYRAC 1 cut(s) 390
HindII GTYRAC 1 cut(s) 390
HinfI GANTC 6 cut(s) 201, 260, 350, 568, 711, 826
HphI GGTGA 2 cut(s) 110, 269
Hpy166II GTNNAC 1 cut(s) 390
Hpy188I TCNGA 2 cut(s) 217, 567
Hpy188III TCNNGA 2 cut(s) 433, 572
Hpy8I GTNNAC 1 cut(s) 390
HpyCH4III ACNGT 4 cut(s) 234, 302, 346, 670
HpyCH4IV ACGT 2 cut(s) 71, 137
HpyCH4V TGCA 1 cut(s) 514
HpyF10VI GCNNNNNNNGC 2 cut(s) 141, 798
HpyF3I CTNAG 6 cut(s) 17, 262, 359, 566, 638, 725
HpySE526I ACGT 2 cut(s) 71, 137
Hsp92II CATG 3 cut(s) 253, 436, 778
Kzo9I GATC 2 cut(s) 91, 168
LpnPI CCDG 7 cut(s) 49, 144, 171, 177, 302, 371, 395
Lsp1109I GCAGC 1 cut(s) 450
LweI GCATC 1 cut(s) 457
MaeI CTAG 3 cut(s) 50, 377, 452
MaeII ACGT 2 cut(s) 71, 137
MaeIII GTNAC 3 cut(s) 116, 257, 569
MalI GATC 2 cut(s) 93, 170
MboI GATC 2 cut(s) 91, 168
MboII GAAGA 2 cut(s) 24, 461
MflI RGATCY 1 cut(s) 168
MhlI GDGCHC 3 cut(s) 137, 322, 774
MlyI GAGTC 3 cut(s) 254, 359, 577
MmeI TCCRAC 2 cut(s) 188, 672
MnlI CCTC 6 cut(s) 40, 182, 298, 415, 610, 761
MseI TTAA 9 cut(s) 222, 396, 405, 458, 497, 653, 665, 705, 795
MslI CAYNNNNRTG 1 cut(s) 431
MspR9I CCNGG 1 cut(s) 159
Mva1269I GAATGC 1 cut(s) 144
MvaI CCWGG 1 cut(s) 159
MwoI GCNNNNNNNGC 2 cut(s) 141, 798
NdeII GATC 2 cut(s) 91, 168
NlaIII CATG 3 cut(s) 253, 436, 778
NlaIV GGNNCC 4 cut(s) 170, 319, 320, 374
NmuCI GTSAC 3 cut(s) 116, 257, 569
PagI TCATGA 1 cut(s) 432
PasI CCCWGGG 1 cut(s) 158
PcsI WCGNNNNNNNCGW 1 cut(s) 350
PctI GAATGC 1 cut(s) 144
PfeI GAWTC 3 cut(s) 201, 711, 826
PkrI GCNGC 1 cut(s) 440
PleI GAGTC 3 cut(s) 254, 358, 576
PmaCI CACGTG 1 cut(s) 138
PmlI CACGTG 1 cut(s) 138
PpsI GAGTC 3 cut(s) 254, 358, 576
Ppu21I YACGTR 1 cut(s) 138
PpuMI RGGWCCY 1 cut(s) 373
PshBI ATTAAT 1 cut(s) 497
Psp5II RGGWCCY 1 cut(s) 373
Psp6I CCWGG 1 cut(s) 157
PspCI CACGTG 1 cut(s) 138
PspGI CCWGG 1 cut(s) 157
PspN4I GGNNCC 4 cut(s) 170, 319, 320, 374
PspOMI GGGCCC 1 cut(s) 318
PspPI GGNCC 3 cut(s) 318, 319, 373
PspPPI RGGWCCY 1 cut(s) 373
PsuI RGATCY 1 cut(s) 168
RsaI GTAC 2 cut(s) 70, 231
RsaNI GTAC 2 cut(s) 69, 230
RseI CAYNNNNRTG 1 cut(s) 431
SaqAI TTAA 9 cut(s) 222, 396, 405, 458, 497, 653, 665, 705, 795
SatI GCNGC 1 cut(s) 439
Sau3AI GATC 2 cut(s) 91, 168
Sau96I GGNCC 3 cut(s) 318, 319, 373
ScaI AGTACT 1 cut(s) 231
SchI GAGTC 3 cut(s) 254, 359, 577
ScrFI CCNGG 1 cut(s) 159
SduI GDGCHC 3 cut(s) 137, 322, 774
SetI ASST 9 cut(s) 23, 74, 140, 360, 378, 426, 621, 682, 803
SfaNI GCATC 1 cut(s) 457
SfcI CTRYAG 1 cut(s) 37
SinI GGWCC 1 cut(s) 373
SmiMI CAYNNNNRTG 1 cut(s) 431
SspMI CTAG 3 cut(s) 50, 377, 452
StyD4I CCNGG 1 cut(s) 157
TaaI ACNGT 4 cut(s) 234, 302, 346, 670
TaiI ACGT 2 cut(s) 74, 140
TaqI TCGA 1 cut(s) 353
TatI WGTACW 1 cut(s) 229
TfiI GAWTC 3 cut(s) 201, 711, 826
Tru1I TTAA 9 cut(s) 222, 396, 405, 458, 497, 653, 665, 705, 795
Tru9I TTAA 9 cut(s) 222, 396, 405, 458, 497, 653, 665, 705, 795
TscAI CASTG 2 cut(s) 196, 270
TseFI GTSAC 3 cut(s) 116, 257, 569
TseI GCWGC 1 cut(s) 438
Tsp45I GTSAC 3 cut(s) 116, 257, 569
TspDTI ATGAA 8 cut(s) 576, 589, 612, 616, 649, 675, 791, 818
TspGWI ACGGA 1 cut(s) 194
TspRI CASTG 2 cut(s) 196, 270
VpaK11BI GGWCC 1 cut(s) 373
VspI ATTAAT 1 cut(s) 497
XapI RAATTY 7 cut(s) 25, 60, 83, 401, 508, 643, 778
XspI CTAG 3 cut(s) 50, 377, 452
ZrmI AGTACT 1 cut(s) 231
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.