pycom01g21380

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
OG0000158
Physical Location & Seq
Forward (+)
19451418 .. 19452117
700 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g21380.1

Sequence Viewer

Length: 267 bp
ATGTTGAAGTTTCGGTCAAGGAATAAACATCAACCAATTTTCATATTCTCGATTATTCCTTACATTGATTATGTAATCTTGAAATCTTGGGTTTTTTTATTCACTTTTGTAATTAAAGACAGATTTTATAACTTTTCGCCCATGGGTGTGATCTTTAAATGTATATTCCCATCTCTACCTAGCACGAGGCCTTTTGGGAGCTCACTGGCTTCGGGTTCCGTAGGAACTCCAAAGTTAAGCGAGAAGGGGGCTAGAGCAATCCCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

89

Amino Acids

10.05

Weight (kDa)

10.35

Isoelectric Point (pI)

38.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 129
AgsI TTSAA 2 cut(s) 7, 82
AluBI AGCT 1 cut(s) 201
AluI AGCT 1 cut(s) 201
Alw21I GWGCWC 1 cut(s) 203
AoxI GGCC 1 cut(s) 188
BanII GRGCYC 1 cut(s) 203
BauI CACGAG 1 cut(s) 184
Bbv12I GWGCWC 1 cut(s) 203
BccI CCATC 1 cut(s) 178
BfaI CTAG 2 cut(s) 180, 252
BmiI GGNNCC 1 cut(s) 217
BsaJI CCNNGG 1 cut(s) 141
Bse1I ACTGG 1 cut(s) 210
BseDI CCNNGG 1 cut(s) 141
BseNI ACTGG 1 cut(s) 210
BshFI GGCC 1 cut(s) 190
BsiHKAI GWGCWC 1 cut(s) 203
BsnI GGCC 1 cut(s) 190
Bsp1286I GDGCHC 1 cut(s) 203
Bsp143I GATC 1 cut(s) 150
Bsp19I CCATGG 1 cut(s) 141
BspANI GGCC 1 cut(s) 190
BspLI GGNNCC 1 cut(s) 217
BsrI ACTGG 1 cut(s) 210
BssECI CCNNGG 1 cut(s) 141
BssMI GATC 1 cut(s) 150
BssSI CACGAG 1 cut(s) 184
BssT1I CCWWGG 1 cut(s) 141
Bst2BI CACGAG 1 cut(s) 184
BstDSI CCRYGG 1 cut(s) 141
BstKTI GATC 1 cut(s) 153
BstMBI GATC 1 cut(s) 150
BsuRI GGCC 1 cut(s) 190
BtgI CCRYGG 1 cut(s) 141
BtsIMutI CAGTG 1 cut(s) 203
CviAII CATG 2 cut(s) 142, 264
CviJI RGCY 4 cut(s) 190, 201, 209, 251
CviKI_1 RGCY 4 cut(s) 190, 201, 209, 251
DpnI GATC 1 cut(s) 152
DpnII GATC 1 cut(s) 150
DraI TTTAAA 1 cut(s) 157
Ecl136II GAGCTC 1 cut(s) 201
Eco130I CCWWGG 1 cut(s) 141
Eco147I AGGCCT 1 cut(s) 190
Eco24I GRGCYC 1 cut(s) 203
Eco53kI GAGCTC 1 cut(s) 201
EcoICRI GAGCTC 1 cut(s) 201
EcoT14I CCWWGG 1 cut(s) 141
EcoT38I GRGCYC 1 cut(s) 203
ErhI CCWWGG 1 cut(s) 141
FaeI CATG 2 cut(s) 145, 267
FaiI YATR 6 cut(s) 44, 72, 129, 143, 164, 265
FatI CATG 2 cut(s) 141, 263
FriOI GRGCYC 1 cut(s) 203
FspBI CTAG 2 cut(s) 180, 252
HaeIII GGCC 1 cut(s) 190
Hin1II CATG 2 cut(s) 145, 267
Hpy188III TCNNGA 2 cut(s) 49, 79
HpyAV CCTTC 1 cut(s) 238
Hsp92II CATG 2 cut(s) 145, 267
Kzo9I GATC 1 cut(s) 150
LmnI GCTCC 1 cut(s) 198
LpnPI CCDG 1 cut(s) 191
MaeI CTAG 2 cut(s) 180, 252
MalI GATC 1 cut(s) 152
MboI GATC 1 cut(s) 150
MhlI GDGCHC 1 cut(s) 203
MluCI AATT 2 cut(s) 36, 111
MnlI CCTC 1 cut(s) 180
MseI TTAA 3 cut(s) 114, 156, 236
MslI CAYNNNNRTG 1 cut(s) 146
NcoI CCATGG 1 cut(s) 141
NdeII GATC 1 cut(s) 150
NlaIII CATG 2 cut(s) 145, 267
NlaIV GGNNCC 1 cut(s) 217
PceI AGGCCT 1 cut(s) 190
PsiI TTATAA 1 cut(s) 129
Psp124BI GAGCTC 1 cut(s) 203
PspN4I GGNNCC 1 cut(s) 217
RseI CAYNNNNRTG 1 cut(s) 146
SacI GAGCTC 1 cut(s) 203
SaqAI TTAA 3 cut(s) 114, 156, 236
Sau3AI GATC 1 cut(s) 150
SduI GDGCHC 1 cut(s) 203
SetI ASST 2 cut(s) 181, 203
SmiMI CAYNNNNRTG 1 cut(s) 146
Sse9I AATT 2 cut(s) 36, 111
SseBI AGGCCT 1 cut(s) 190
SspMI CTAG 2 cut(s) 180, 252
SstI GAGCTC 1 cut(s) 203
StuI AGGCCT 1 cut(s) 190
StyI CCWWGG 1 cut(s) 141
TaqI TCGA 1 cut(s) 50
TasI AATT 2 cut(s) 36, 111
Tru1I TTAA 3 cut(s) 114, 156, 236
Tru9I TTAA 3 cut(s) 114, 156, 236
TscAI CASTG 1 cut(s) 210
TspDTI ATGAA 1 cut(s) 31
TspGWI ACGGA 1 cut(s) 208
TspRI CASTG 1 cut(s) 210
XspI CTAG 2 cut(s) 180, 252
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.