pycom12g09520

Receptor-like protein 2

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
OG0000158
Physical Location & Seq
Forward (+)
11467904 .. 11468353
450 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12g09520.3

Sequence Viewer

Length: 366 bp
ATGTCACATCCCGGCCCGGGCGGGACTACTTCCCGGGCCCGACTCCATTACCGTAGCACGATATTGTCCGCTTTGGGCTTACCATTCCCTCACGGTTTTGTTTTTGGGAACTCACGAGCAACTTCCCAGTGGGTCACCCATCATGGGATTGCTCTAGCCCCCTCCTCGCTTAACTTCGGAGTTCCTATAGAACCCGAAGCCAGTGAGCTCCCAAAAAGCCTTGTGCTAGGTAGGGATGAGAATATACATTTAAGGATCATCCCCTGGACGATGTGGGATCATTTTCCTTTTGTTATGACGATTCTTAGAGATATCCTTCCTCCTAGTCTTCCTCTTACTAGGGTTGGAGTGGGTCTTAATCAATAA

Protein Analysis

122

Amino Acids

13.31

Weight (kDa)

9.94

Isoelectric Point (pI)

56.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 21, 69
AclWI GGATC 2 cut(s) 263, 285
AfiI CCNNNNNNNGG 2 cut(s) 17, 144
AjnI CCWGG 1 cut(s) 263
AluBI AGCT 1 cut(s) 208
AluI AGCT 1 cut(s) 208
Alw21I GWGCWC 1 cut(s) 210
AlwI GGATC 2 cut(s) 263, 285
Ama87I CYCGRG 2 cut(s) 16, 33
AoxI GGCC 2 cut(s) 13, 36
ApaI GGGCCC 1 cut(s) 40
AspS9I GGNCC 3 cut(s) 14, 36, 37
AsuC2I CCSGG 5 cut(s) 12, 17, 18, 34, 35
AsuHPI GGTGA 1 cut(s) 127
AvaI CYCGRG 2 cut(s) 16, 33
BaeGI GKGCMC 1 cut(s) 40
BanII GRGCYC 2 cut(s) 40, 210
BauI CACGAG 1 cut(s) 114
BbsI GAAGAC 1 cut(s) 320
Bbv12I GWGCWC 1 cut(s) 210
BccI CCATC 1 cut(s) 147
BciT130I CCWGG 1 cut(s) 265
BcnI CCSGG 5 cut(s) 12, 17, 18, 34, 35
BfaI CTAG 4 cut(s) 155, 227, 324, 339
BfmI CTRYAG 1 cut(s) 186
Bme1390I CCNGG 6 cut(s) 12, 17, 18, 34, 35, 265
BmeT110I CYCGRG 2 cut(s) 16, 33
BmgT120I GGNCC 3 cut(s) 14, 36, 37
BmiI GGNNCC 1 cut(s) 38
BmrFI CCNGG 6 cut(s) 12, 17, 18, 34, 35, 265
BmrI ACTGGG 1 cut(s) 121
BmuI ACTGGG 1 cut(s) 121
BpiI GAAGAC 1 cut(s) 320
BpuMI CCSGG 5 cut(s) 12, 17, 18, 34, 35
BsaJI CCNNGG 3 cut(s) 16, 33, 263
Bsc4I CCNNNNNNNGG 2 cut(s) 17, 144
Bse1I ACTGG 2 cut(s) 127, 201
BseBI CCWGG 1 cut(s) 265
BseDI CCNNGG 3 cut(s) 16, 33, 263
BseGI GGATG 3 cut(s) 7, 241, 258
BseLI CCNNNNNNNGG 2 cut(s) 17, 144
BseNI ACTGG 2 cut(s) 127, 201
BseRI GAGGAG 1 cut(s) 154
BseSI GKGCMC 1 cut(s) 40
BshFI GGCC 2 cut(s) 15, 38
BsiHKAI GWGCWC 1 cut(s) 210
BsiHKCI CYCGRG 2 cut(s) 16, 33
BsiSI CCGG 3 cut(s) 12, 17, 34
BslFI GGGAC 1 cut(s) 37
BslI CCNNNNNNNGG 2 cut(s) 17, 144
BsmFI GGGAC 1 cut(s) 37
BsnI GGCC 2 cut(s) 15, 38
BsoBI CYCGRG 2 cut(s) 16, 33
Bsp120I GGGCCC 1 cut(s) 36
Bsp1286I GDGCHC 2 cut(s) 40, 210
Bsp143I GATC 2 cut(s) 255, 277
BspACI CCGC 2 cut(s) 21, 69
BspANI GGCC 2 cut(s) 15, 38
BspLI GGNNCC 1 cut(s) 38
BspPI GGATC 2 cut(s) 263, 285
BsrI ACTGG 2 cut(s) 127, 201
BssECI CCNNGG 3 cut(s) 16, 33, 263
BssMI GATC 2 cut(s) 255, 277
BssSI CACGAG 1 cut(s) 114
Bst2BI CACGAG 1 cut(s) 114
Bst2UI CCWGG 1 cut(s) 265
Bst4CI ACNGT 2 cut(s) 53, 95
BstDEI CTNAG 1 cut(s) 305
BstEII GGTNACC 1 cut(s) 133
BstF5I GGATG 3 cut(s) 7, 241, 258
BstKTI GATC 2 cut(s) 258, 280
BstMBI GATC 2 cut(s) 255, 277
BstNI CCWGG 1 cut(s) 265
BstPI GGTNACC 1 cut(s) 133
BstSCI CCNGG 6 cut(s) 10, 15, 16, 32, 33, 263
BstSFI CTRYAG 1 cut(s) 186
BstSLI GKGCMC 1 cut(s) 40
BstV2I GAAGAC 1 cut(s) 320
BsuRI GGCC 2 cut(s) 15, 38
BtsCI GGATG 3 cut(s) 7, 241, 258
BtsIMutI CAGTG 2 cut(s) 134, 208
Cfr13I GGNCC 3 cut(s) 14, 36, 37
Cfr9I CCCGGG 2 cut(s) 16, 33
CviAII CATG 1 cut(s) 143
CviJI RGCY 7 cut(s) 15, 38, 78, 158, 200, 208, 219
CviKI_1 RGCY 7 cut(s) 15, 38, 78, 158, 200, 208, 219
DdeI CTNAG 1 cut(s) 305
DpnI GATC 2 cut(s) 257, 279
DpnII GATC 2 cut(s) 255, 277
Ecl136II GAGCTC 1 cut(s) 208
Eco24I GRGCYC 2 cut(s) 40, 210
Eco32I GATATC 1 cut(s) 313
Eco53kI GAGCTC 1 cut(s) 208
Eco88I CYCGRG 2 cut(s) 16, 33
Eco91I GGTNACC 1 cut(s) 133
EcoICRI GAGCTC 1 cut(s) 208
EcoO65I GGTNACC 1 cut(s) 133
EcoRII CCWGG 1 cut(s) 263
EcoRV GATATC 1 cut(s) 313
EcoT38I GRGCYC 2 cut(s) 40, 210
FaeI CATG 1 cut(s) 146
FaiI YATR 4 cut(s) 144, 188, 245, 296
FaqI GGGAC 1 cut(s) 37
FatI CATG 1 cut(s) 142
FauI CCCGC 1 cut(s) 14
FokI GGATG 2 cut(s) 245, 248
FriOI GRGCYC 2 cut(s) 40, 210
FspBI CTAG 4 cut(s) 155, 227, 324, 339
HaeIII GGCC 2 cut(s) 15, 38
HapII CCGG 3 cut(s) 12, 17, 34
Hin1II CATG 1 cut(s) 146
HinfI GANTC 2 cut(s) 42, 301
HpaII CCGG 3 cut(s) 12, 17, 34
HphI GGTGA 1 cut(s) 127
Hpy188I TCNGA 1 cut(s) 179
Hpy188III TCNNGA 1 cut(s) 114
HpyAV CCTTC 1 cut(s) 326
HpyCH4III ACNGT 2 cut(s) 53, 95
HpyF3I CTNAG 1 cut(s) 305
Hsp92II CATG 1 cut(s) 146
Kzo9I GATC 2 cut(s) 255, 277
LmnI GCTCC 1 cut(s) 213
LpnPI CCDG 7 cut(s) 25, 30, 47, 140, 214, 250, 277
MaeI CTAG 4 cut(s) 155, 227, 324, 339
MaeIII GTNAC 2 cut(s) 3, 133
MalI GATC 2 cut(s) 257, 279
MboI GATC 2 cut(s) 255, 277
MboII GAAGA 1 cut(s) 320
MhlI GDGCHC 2 cut(s) 40, 210
MlyI GAGTC 1 cut(s) 36
MmeI TCCRAC 1 cut(s) 325
MnlI CCTC 5 cut(s) 99, 172, 175, 330, 342
MseI TTAA 3 cut(s) 171, 251, 357
MspI CCGG 3 cut(s) 12, 17, 34
MspR9I CCNGG 6 cut(s) 12, 17, 18, 34, 35, 265
MvaI CCWGG 1 cut(s) 265
NciI CCSGG 5 cut(s) 12, 17, 18, 34, 35
NdeII GATC 2 cut(s) 255, 277
NlaIII CATG 1 cut(s) 146
NlaIV GGNNCC 1 cut(s) 38
NmuCI GTSAC 2 cut(s) 3, 133
PfeI GAWTC 1 cut(s) 301
PleI GAGTC 1 cut(s) 36
PpsI GAGTC 1 cut(s) 36
Psp124BI GAGCTC 1 cut(s) 210
Psp6I CCWGG 1 cut(s) 263
PspEI GGTNACC 1 cut(s) 133
PspGI CCWGG 1 cut(s) 263
PspN4I GGNNCC 1 cut(s) 38
PspOMI GGGCCC 1 cut(s) 36
PspPI GGNCC 3 cut(s) 14, 36, 37
SacI GAGCTC 1 cut(s) 210
SaqAI TTAA 3 cut(s) 171, 251, 357
Sau3AI GATC 2 cut(s) 255, 277
Sau96I GGNCC 3 cut(s) 14, 36, 37
SchI GAGTC 1 cut(s) 36
ScrFI CCNGG 6 cut(s) 12, 17, 18, 34, 35, 265
SduI GDGCHC 2 cut(s) 40, 210
SetI ASST 2 cut(s) 210, 232
SfcI CTRYAG 1 cut(s) 186
SmaI CCCGGG 2 cut(s) 18, 35
SrfI GCCCGGGC 1 cut(s) 18
SsiI CCGC 2 cut(s) 21, 69
SspMI CTAG 4 cut(s) 155, 227, 324, 339
SstI GAGCTC 1 cut(s) 210
StyD4I CCNGG 6 cut(s) 10, 15, 16, 32, 33, 263
TaaI ACNGT 2 cut(s) 53, 95
TfiI GAWTC 1 cut(s) 301
Tru1I TTAA 3 cut(s) 171, 251, 357
Tru9I TTAA 3 cut(s) 171, 251, 357
TscAI CASTG 2 cut(s) 134, 208
TseFI GTSAC 2 cut(s) 3, 133
Tsp45I GTSAC 2 cut(s) 3, 133
TspMI CCCGGG 2 cut(s) 16, 33
TspRI CASTG 2 cut(s) 134, 208
XmaI CCCGGG 2 cut(s) 16, 33
XspI CTAG 4 cut(s) 155, 227, 324, 339
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.