pycom17g16340

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
OG0000158
Physical Location & Seq
Forward (+)
14509491 .. 14510924
1434 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom17g16340.6

Sequence Viewer

Length: 1014 bp
ATGAATAAGGCCCCAAAAGGGGGTGAGTTCAAAGTCCTAGCGGGAGTAGGGTTGTTCGAAGCAGAGTCAGAACGAAACAAGAACTCCCAATCCGGAAATACAAAAAATCATGCAACGATTGAGGACCTTCAATTCAACACACAATTGCATGCGCAAAACCTCTCAAACATGTTGAGATTTTTCCTTTTCTTTTTTTCCGCCGACATACCTTCAATTTCGATAAACAGCACTGTGGAAAGCATCTTCAGTTTGGATAAACAGCACTGCAGCGAGGCCGACTGGTTACCTATCCAAGTCTCGGCCGATAAGGGTTTTCGAATCCTTATTGGTAGAGGTCATCTTATTAGCCTTCTTGGCGAAGTAAGGTGTTACAAGTTACGACATTCGACGTACTGGATGCCGAGTGATTGTATGATTGGATACTCACAAGTGAGTTTTAAATCTGGTGTCGATTCGACGTGCTTATACTCTTACGAATATAATCACGGTGACCGAATCAGGCGCCGACGACTCGTGAACTTCGCAGAATTAATAGCCTTATCTTCAGGCTCTAGAACCCAAAGACCGAGAGTGTTCTTTCCTCGGTTGCAGTCTTTACTCCTCGGCCGACGAGTTGGCACGCCCCGTACTTTACGGAAGGACGTAGTTAGCTTATTAGTTACTCGGCCTGCGCGCCACATAGGTTTTGTAATTTTTAGAGTCAACAGTTACAACACAGAAATTGATAGTGATTTGGTGAAGAGATCAGCCATATTGTCTTGTGAACGGATTTGCGTAACTTCAATCTTTGTCTCATTTGATGTAATGCTTGCTAAGCTTCGAATATGGCCCACAACTACTCTTAGTAAAAAACATTCCCAAGTAGCTTCATGTAAGGAGAGAATTTTAGCATGGTTAGACGAAGAGGAAACTAAGGTTTGTTTAATTAACCTCCAAGACATAACCAATTTGAGAGCGCGTCTTGTAGGAATCGACTCGAGATTAGGGGGTGCGGCATTACTCGAGGATCTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

338

Amino Acids

38.18

Weight (kDa)

9.45

Isoelectric Point (pI)

47.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 153
AccB1I GGYRCC 1 cut(s) 501
AccII CGCG 2 cut(s) 673, 958
AccIII TCCGGA 1 cut(s) 92
AciI CCGC 3 cut(s) 41, 198, 992
AcoI YGGCCR 2 cut(s) 300, 604
AcsI RAATTY 1 cut(s) 882
AcuI CTGAAG 2 cut(s) 229, 528
AcyI GRCGYC 1 cut(s) 502
AfaI GTAC 2 cut(s) 392, 628
AfiI CCNNNNNNNGG 4 cut(s) 18, 19, 20, 298
AflIII ACRYGT 1 cut(s) 168
AgsI TTSAA 5 cut(s) 31, 131, 136, 213, 783
AjiI CACGTC 1 cut(s) 459
AloI GAACNNNNNNTCC 2 cut(s) 74, 106
AluBI AGCT 3 cut(s) 651, 817, 866
AluI AGCT 3 cut(s) 651, 817, 866
Alw26I GTCTC 2 cut(s) 301, 796
Ama87I CYCGRG 2 cut(s) 976, 1001
Aor13HI TCCGGA 1 cut(s) 92
AoxI GGCC 6 cut(s) 9, 273, 300, 604, 665, 827
ApeKI GCWGC 1 cut(s) 267
ApoI RAATTY 1 cut(s) 882
AseI ATTAAT 1 cut(s) 530
AspLEI GCGC 5 cut(s) 154, 504, 673, 675, 958
AspS9I GGNCC 3 cut(s) 10, 124, 828
AsuHPI GGTGA 3 cut(s) 35, 500, 748
AsuII TTCGAA 3 cut(s) 57, 316, 820
AvaI CYCGRG 2 cut(s) 976, 1001
AvaII GGWCC 1 cut(s) 124
BanI GGYRCC 1 cut(s) 501
BauI CACGAG 1 cut(s) 512
BbvI GCAGC 1 cut(s) 279
BciVI GTATCC 1 cut(s) 413
BcoDI GTCTC 2 cut(s) 301, 796
BfaI CTAG 2 cut(s) 38, 552
BfmI CTRYAG 2 cut(s) 265, 1010
BfoI RGCGCY 1 cut(s) 505
BfuI GTATCC 1 cut(s) 413
BglI GCCNNNNNGGC 1 cut(s) 354
BisI GCNGC 2 cut(s) 268, 993
BlpI GCTNAGC 1 cut(s) 813
BlsI GCNGC 2 cut(s) 269, 994
Bme18I GGWCC 1 cut(s) 124
BmeT110I CYCGRG 2 cut(s) 976, 1001
BmgBI CACGTC 1 cut(s) 459
BmgT120I GGNCC 3 cut(s) 10, 124, 828
BmiI GGNNCC 2 cut(s) 12, 503
BmsI GCATC 2 cut(s) 249, 387
Bpu1102I GCTNAGC 1 cut(s) 813
Bpu14I TTCGAA 3 cut(s) 57, 316, 820
BsaHI GRCGYC 1 cut(s) 502
BsaJI CCNNGG 2 cut(s) 581, 601
BsaWI WCCGGW 1 cut(s) 92
BsaXI ACNNNNNCTCC 2 cut(s) 68, 98
Bsc4I CCNNNNNNNGG 4 cut(s) 18, 19, 20, 298
Bse1I ACTGG 2 cut(s) 284, 398
BseAI TCCGGA 1 cut(s) 92
BseDI CCNNGG 2 cut(s) 581, 601
BseGI GGATG 1 cut(s) 402
BseLI CCNNNNNNNGG 4 cut(s) 18, 19, 20, 298
BseNI ACTGG 2 cut(s) 284, 398
BsePI GCGCGC 1 cut(s) 671
BseRI GAGGAG 1 cut(s) 590
BseX3I CGGCCG 2 cut(s) 300, 604
BseXI GCAGC 1 cut(s) 279
Bsh1236I CGCG 2 cut(s) 673, 958
Bsh1285I CGRYCG 2 cut(s) 303, 607
BshFI GGCC 6 cut(s) 11, 275, 302, 606, 667, 829
BshNI GGYRCC 1 cut(s) 501
BsiEI CGRYCG 2 cut(s) 303, 607
BsiHKCI CYCGRG 2 cut(s) 976, 1001
BsiSI CCGG 1 cut(s) 93
BslI CCNNNNNNNGG 4 cut(s) 18, 19, 20, 298
BsmAI GTCTC 2 cut(s) 301, 796
BsnI GGCC 6 cut(s) 11, 275, 302, 606, 667, 829
BsoBI CYCGRG 2 cut(s) 976, 1001
Bsp119I TTCGAA 3 cut(s) 57, 316, 820
Bsp13I TCCGGA 1 cut(s) 92
Bsp143I GATC 2 cut(s) 743, 1006
Bsp1720I GCTNAGC 1 cut(s) 813
BspACI CCGC 3 cut(s) 41, 198, 992
BspANI GGCC 6 cut(s) 11, 275, 302, 606, 667, 829
BspEI TCCGGA 1 cut(s) 92
BspFNI CGCG 2 cut(s) 673, 958
BspLI GGNNCC 2 cut(s) 12, 503
BspMAI CTGCAG 1 cut(s) 269
BspT104I TTCGAA 3 cut(s) 57, 316, 820
BspT107I GGYRCC 1 cut(s) 501
BsrI ACTGG 2 cut(s) 284, 398
BssECI CCNNGG 2 cut(s) 581, 601
BssHII GCGCGC 1 cut(s) 671
BssMI GATC 2 cut(s) 743, 1006
BssNI GRCGYC 1 cut(s) 502
BssSI CACGAG 1 cut(s) 512
Bst2BI CACGAG 1 cut(s) 512
Bst4CI ACNGT 3 cut(s) 232, 488, 707
Bst6I CTCTTC 2 cut(s) 734, 897
BstACI GRCGYC 1 cut(s) 502
BstBI TTCGAA 3 cut(s) 57, 316, 820
BstC8I GCNNGC 5 cut(s) 150, 620, 669, 673, 810
BstDEI CTNAG 3 cut(s) 813, 842, 912
BstEII GGTNACC 2 cut(s) 282, 488
BstF5I GGATG 1 cut(s) 402
BstFNI CGCG 2 cut(s) 673, 958
BstH2I RGCGCY 1 cut(s) 505
BstHHI GCGC 5 cut(s) 154, 504, 673, 675, 958
BstKTI GATC 2 cut(s) 746, 1009
BstMAI GTCTC 2 cut(s) 301, 796
BstMBI GATC 2 cut(s) 743, 1006
BstMCI CGRYCG 2 cut(s) 303, 607
BstMWI GCNNNNNNNGC 2 cut(s) 354, 814
BstNSI RCATGY 2 cut(s) 152, 172
BstPI GGTNACC 2 cut(s) 282, 488
BstSFI CTRYAG 2 cut(s) 265, 1010
BstUI CGCG 2 cut(s) 673, 958
BstV1I GCAGC 1 cut(s) 279
BstX2I RGATCY 1 cut(s) 1006
BstYI RGATCY 1 cut(s) 1006
BstZI CGGCCG 2 cut(s) 300, 604
BsuI GTATCC 1 cut(s) 413
BsuRI GGCC 6 cut(s) 11, 275, 302, 606, 667, 829
BtrI CACGTC 1 cut(s) 459
BtsCI GGATG 1 cut(s) 402
BtsI GCAGTG 1 cut(s) 262
BtsIMutI CAGTG 2 cut(s) 228, 262
Cac8I GCNNGC 5 cut(s) 150, 620, 669, 673, 810
CfoI GCGC 5 cut(s) 154, 504, 673, 675, 958
Cfr13I GGNCC 3 cut(s) 10, 124, 828
CseI GACGC 1 cut(s) 947
Csp6I GTAC 2 cut(s) 391, 627
CviAII CATG 5 cut(s) 110, 149, 169, 870, 891
CviQI GTAC 2 cut(s) 391, 627
DdeI CTNAG 3 cut(s) 813, 842, 912
DinI GGCGCC 1 cut(s) 503
DpnI GATC 2 cut(s) 745, 1008
DpnII GATC 2 cut(s) 743, 1006
DraI TTTAAA 1 cut(s) 439
EaeI YGGCCR 2 cut(s) 300, 604
EagI CGGCCG 2 cut(s) 300, 604
Eam1104I CTCTTC 2 cut(s) 734, 897
EarI CTCTTC 2 cut(s) 734, 897
EciI GGCGGA 1 cut(s) 187
EclXI CGGCCG 2 cut(s) 300, 604
Eco47I GGWCC 1 cut(s) 124
Eco52I CGGCCG 2 cut(s) 300, 604
Eco57I CTGAAG 2 cut(s) 229, 528
Eco88I CYCGRG 2 cut(s) 976, 1001
Eco91I GGTNACC 2 cut(s) 282, 488
EcoO109I RGGNCCY 2 cut(s) 10, 124
EcoO65I GGTNACC 2 cut(s) 282, 488
EgeI GGCGCC 1 cut(s) 503
EheI GGCGCC 1 cut(s) 503
FaeI CATG 5 cut(s) 113, 152, 172, 873, 894
FatI CATG 5 cut(s) 109, 148, 168, 869, 890
FauI CCCGC 1 cut(s) 34
Fnu4HI GCNGC 2 cut(s) 268, 993
FokI GGATG 1 cut(s) 409
Fsp4HI GCNGC 2 cut(s) 268, 993
FspBI CTAG 2 cut(s) 38, 552
FspI TGCGCA 1 cut(s) 153
GlaI GCGC 5 cut(s) 153, 503, 672, 674, 957
GluI GCNGC 2 cut(s) 268, 993
HaeII RGCGCY 1 cut(s) 505
HaeIII GGCC 6 cut(s) 11, 275, 302, 606, 667, 829
HapII CCGG 1 cut(s) 93
HgaI GACGC 1 cut(s) 947
HhaI GCGC 5 cut(s) 154, 504, 673, 675, 958
Hin1I GRCGYC 1 cut(s) 502
Hin1II CATG 5 cut(s) 113, 152, 172, 873, 894
Hin6I GCGC 5 cut(s) 152, 502, 671, 673, 956
HinP1I GCGC 5 cut(s) 152, 502, 671, 673, 956
HincII GTYRAC 1 cut(s) 703
HindII GTYRAC 1 cut(s) 703
HindIII AAGCTT 1 cut(s) 815
HinfI GANTC 8 cut(s) 65, 318, 452, 495, 510, 699, 969, 974
HpaII CCGG 1 cut(s) 93
HphI GGTGA 3 cut(s) 35, 500, 748
Hpy166II GTNNAC 3 cut(s) 517, 703, 764
Hpy188I TCNGA 1 cut(s) 70
Hpy188III TCNNGA 4 cut(s) 93, 514, 552, 978
Hpy8I GTNNAC 3 cut(s) 517, 703, 764
Hpy99I CGWCG 4 cut(s) 391, 460, 510, 612
HpyAV CCTTC 4 cut(s) 137, 219, 359, 631
HpyCH4III ACNGT 3 cut(s) 232, 488, 707
HpyCH4IV ACGT 3 cut(s) 389, 458, 642
HpyCH4V TGCA 4 cut(s) 113, 148, 267, 589
HpyF10VI GCNNNNNNNGC 2 cut(s) 354, 814
HpyF3I CTNAG 3 cut(s) 813, 842, 912
HpySE526I ACGT 3 cut(s) 389, 458, 642
Hsp92I GRCGYC 1 cut(s) 502
Hsp92II CATG 5 cut(s) 113, 152, 172, 873, 894
HspAI GCGC 5 cut(s) 152, 502, 671, 673, 956
KasI GGCGCC 1 cut(s) 501
Kpn2I TCCGGA 1 cut(s) 92
Kzo9I GATC 2 cut(s) 743, 1006
LpnPI CCDG 7 cut(s) 106, 265, 379, 429, 484, 531, 681
Lsp1109I GCAGC 1 cut(s) 279
LweI GCATC 2 cut(s) 249, 387
MaeI CTAG 2 cut(s) 38, 552
MaeII ACGT 3 cut(s) 389, 458, 642
MaeIII GTNAC 7 cut(s) 282, 368, 375, 488, 658, 707, 775
MalI GATC 2 cut(s) 745, 1008
MboI GATC 2 cut(s) 743, 1006
MboII GAAGA 4 cut(s) 235, 534, 751, 914
MfeI CAATTG 1 cut(s) 143
MflI RGATCY 1 cut(s) 1006
MluCI AATT 9 cut(s) 131, 143, 213, 527, 690, 720, 882, 924, 946
Mly113I GGCGCC 1 cut(s) 502
MlyI GAGTC 4 cut(s) 74, 504, 708, 968
MnlI CCTC 9 cut(s) 115, 170, 265, 326, 591, 611, 898, 941, 997
MroI TCCGGA 1 cut(s) 92
MseI TTAA 4 cut(s) 438, 530, 923, 927
MspI CCGG 1 cut(s) 93
MunI CAATTG 1 cut(s) 143
MvnI CGCG 2 cut(s) 673, 958
MwoI GCNNNNNNNGC 2 cut(s) 354, 814
NarI GGCGCC 1 cut(s) 502
NdeII GATC 2 cut(s) 743, 1006
NlaIII CATG 5 cut(s) 113, 152, 172, 873, 894
NlaIV GGNNCC 2 cut(s) 12, 503
NmeAIII GCCGAG 4 cut(s) 278, 426, 582, 643
NmuCI GTSAC 1 cut(s) 488
NsbI TGCGCA 1 cut(s) 153
NspI RCATGY 2 cut(s) 152, 172
NspV TTCGAA 3 cut(s) 57, 316, 820
PacI TTAATTAA 1 cut(s) 927
PaeI GCATGC 1 cut(s) 152
PaeR7I CTCGAG 2 cut(s) 976, 1001
PauI GCGCGC 1 cut(s) 671
PciI ACATGT 1 cut(s) 168
PfeI GAWTC 4 cut(s) 318, 452, 495, 969
PkrI GCNGC 2 cut(s) 269, 994
PleI GAGTC 4 cut(s) 73, 504, 707, 968
PluTI GGCGCC 1 cut(s) 505
PpsI GAGTC 4 cut(s) 73, 504, 707, 968
PpuMI RGGWCCY 1 cut(s) 124
PscI ACATGT 1 cut(s) 168
PshBI ATTAAT 1 cut(s) 530
Psp5II RGGWCCY 1 cut(s) 124
PspEI GGTNACC 2 cut(s) 282, 488
PspN4I GGNNCC 2 cut(s) 12, 503
PspPI GGNCC 3 cut(s) 10, 124, 828
PspPPI RGGWCCY 1 cut(s) 124
PspXI VCTCGAGB 1 cut(s) 1001
PstI CTGCAG 1 cut(s) 269
PsuI RGATCY 1 cut(s) 1006
PteI GCGCGC 1 cut(s) 671
RsaI GTAC 2 cut(s) 392, 628
RsaNI GTAC 2 cut(s) 391, 627
SaqAI TTAA 4 cut(s) 438, 530, 923, 927
SatI GCNGC 2 cut(s) 268, 993
Sau3AI GATC 2 cut(s) 743, 1006
Sau96I GGNCC 3 cut(s) 10, 124, 828
SchI GAGTC 4 cut(s) 74, 504, 708, 968
SfaNI GCATC 2 cut(s) 249, 387
SfcI CTRYAG 2 cut(s) 265, 1010
SfoI GGCGCC 1 cut(s) 503
Sfr274I CTCGAG 2 cut(s) 976, 1001
SfuI TTCGAA 3 cut(s) 57, 316, 820
SinI GGWCC 1 cut(s) 124
SlaI CTCGAG 2 cut(s) 976, 1001
SmlI CTYRAG 2 cut(s) 976, 1001
SmoI CTYRAG 2 cut(s) 976, 1001
SphI GCATGC 1 cut(s) 152
Sse9I AATT 9 cut(s) 131, 143, 213, 527, 690, 720, 882, 924, 946
SsiI CCGC 3 cut(s) 41, 198, 992
SspDI GGCGCC 1 cut(s) 501
SspMI CTAG 2 cut(s) 38, 552
TaaI ACNGT 3 cut(s) 232, 488, 707
TaiI ACGT 3 cut(s) 392, 461, 645
TaqII GACCGA 2 cut(s) 507, 580
TasI AATT 9 cut(s) 131, 143, 213, 527, 690, 720, 882, 924, 946
TauI GCSGC 1 cut(s) 995
TfiI GAWTC 4 cut(s) 318, 452, 495, 969
Tru1I TTAA 4 cut(s) 438, 530, 923, 927
Tru9I TTAA 4 cut(s) 438, 530, 923, 927
TscAI CASTG 2 cut(s) 235, 269
TseFI GTSAC 1 cut(s) 488
TseI GCWGC 1 cut(s) 267
Tsp45I GTSAC 1 cut(s) 488
TspDTI ATGAA 2 cut(s) 17, 858
TspGWI ACGGA 2 cut(s) 649, 781
TspRI CASTG 2 cut(s) 235, 269
VpaK11BI GGWCC 1 cut(s) 124
VspI ATTAAT 1 cut(s) 530
XapI RAATTY 1 cut(s) 882
XbaI TCTAGA 1 cut(s) 551
XceI RCATGY 2 cut(s) 152, 172
XhoI CTCGAG 2 cut(s) 976, 1001
XspI CTAG 2 cut(s) 38, 552
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.