pycom08g11940

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr8
OG0000158
Physical Location & Seq
Forward (+)
10233450 .. 10234029
580 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom08g11940.2

Sequence Viewer

Length: 411 bp
ATGTCACAATCCACCCTCCTTAGGGGCCCGACGTCCTCGTCGGCACACCACGACCAGGACCAAATTGTCACATCCCGGCCCAGGCGGATCACGTCCCGGGACCCGCTCCACCACCGTAGCACGATATTGTCCGCTTTGGGCTTACCATTCCCTCACAGTTTTGTTTTTGGGAACTCACGAGCAACTTCCCAGTGGGTCACCCATCATGGGATTGCTTTAGCCCCCTTCTCGCTTAACTTCGGAGTTCCTACGGAACCCGAAGCCAGTGAGCTCCCAAAAGGCCTCGTGCTAGGTAGGGATGGGAATATACATTTAAGGATCACTCCCCTGGGCGATGTGGGATGTCACAATCCACCCCCCTTAGGGGCCCGACGTCCTCGTCGCACACACGCAACCAGAGTTAGGCTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

137

Amino Acids

14.91

Weight (kDa)

11.7

Isoelectric Point (pI)

66.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 3 cut(s) 37, 65, 378
AatII GACGTC 2 cut(s) 35, 376
AccBSI CCGCTC 1 cut(s) 106
AciI CCGC 3 cut(s) 85, 104, 132
AclWI GGATC 2 cut(s) 95, 326
AcyI GRCGYC 2 cut(s) 32, 373
AfiI CCNNNNNNNGG 9 cut(s) 21, 22, 55, 81, 207, 362, 363, 364, 402
AjiI CACGTC 1 cut(s) 93
AjnI CCWGG 3 cut(s) 54, 80, 327
AluBI AGCT 1 cut(s) 271
AluI AGCT 1 cut(s) 271
Alw21I GWGCWC 1 cut(s) 273
AlwI GGATC 2 cut(s) 95, 326
Ama87I CYCGRG 1 cut(s) 96
AoxI GGCC 4 cut(s) 25, 77, 280, 366
ApaI GGGCCC 2 cut(s) 29, 370
AspS9I GGNCC 7 cut(s) 25, 26, 58, 78, 100, 366, 367
AsuC2I CCSGG 3 cut(s) 76, 97, 98
AsuHPI GGTGA 1 cut(s) 190
AvaI CYCGRG 1 cut(s) 96
AvaII GGWCC 2 cut(s) 58, 100
AxyI CCTNAGG 2 cut(s) 20, 361
BaeGI GKGCMC 2 cut(s) 29, 370
BanII GRGCYC 3 cut(s) 29, 273, 370
BauI CACGAG 2 cut(s) 177, 284
Bbv12I GWGCWC 1 cut(s) 273
BccI CCATC 2 cut(s) 210, 293
BciT130I CCWGG 3 cut(s) 56, 82, 329
BcnI CCSGG 3 cut(s) 76, 97, 98
BfaI CTAG 1 cut(s) 290
Bme1390I CCNGG 6 cut(s) 56, 76, 82, 97, 98, 329
Bme18I GGWCC 2 cut(s) 58, 100
BmeT110I CYCGRG 1 cut(s) 96
BmgBI CACGTC 1 cut(s) 93
BmgT120I GGNCC 7 cut(s) 25, 26, 58, 78, 100, 366, 367
BmiI GGNNCC 7 cut(s) 26, 27, 101, 102, 255, 367, 368
BmrFI CCNGG 6 cut(s) 56, 76, 82, 97, 98, 329
BmrI ACTGGG 1 cut(s) 184
BmuI ACTGGG 1 cut(s) 184
BplI GAGNNNNNCTC 1 cut(s) 390
BpuMI CCSGG 3 cut(s) 76, 97, 98
BsaHI GRCGYC 2 cut(s) 32, 373
BsaJI CCNNGG 4 cut(s) 80, 96, 327, 328
Bsc4I CCNNNNNNNGG 9 cut(s) 21, 22, 55, 81, 207, 362, 363, 364, 402
Bse1I ACTGG 2 cut(s) 190, 264
Bse21I CCTNAGG 2 cut(s) 20, 361
BseBI CCWGG 3 cut(s) 56, 82, 329
BseDI CCNNGG 4 cut(s) 80, 96, 327, 328
BseGI GGATG 3 cut(s) 71, 304, 347
BseLI CCNNNNNNNGG 9 cut(s) 21, 22, 55, 81, 207, 362, 363, 364, 402
BseNI ACTGG 2 cut(s) 190, 264
BseSI GKGCMC 2 cut(s) 29, 370
BshFI GGCC 4 cut(s) 27, 79, 282, 368
BsiHKAI GWGCWC 1 cut(s) 273
BsiHKCI CYCGRG 1 cut(s) 96
BsiSI CCGG 2 cut(s) 76, 97
BslFI GGGAC 2 cut(s) 79, 113
BslI CCNNNNNNNGG 9 cut(s) 21, 22, 55, 81, 207, 362, 363, 364, 402
BsmFI GGGAC 2 cut(s) 79, 113
BsnI GGCC 4 cut(s) 27, 79, 282, 368
BsoBI CYCGRG 1 cut(s) 96
Bsp120I GGGCCC 2 cut(s) 25, 366
Bsp1286I GDGCHC 3 cut(s) 29, 273, 370
Bsp143I GATC 2 cut(s) 87, 318
BspACI CCGC 3 cut(s) 85, 104, 132
BspANI GGCC 4 cut(s) 27, 79, 282, 368
BspLI GGNNCC 7 cut(s) 26, 27, 101, 102, 255, 367, 368
BspPI GGATC 2 cut(s) 95, 326
BsrBI CCGCTC 1 cut(s) 106
BsrI ACTGG 2 cut(s) 190, 264
BssECI CCNNGG 4 cut(s) 80, 96, 327, 328
BssMI GATC 2 cut(s) 87, 318
BssNI GRCGYC 2 cut(s) 32, 373
BssSI CACGAG 2 cut(s) 177, 284
Bst2BI CACGAG 2 cut(s) 177, 284
Bst2UI CCWGG 3 cut(s) 56, 82, 329
Bst4CI ACNGT 2 cut(s) 116, 158
BstACI GRCGYC 2 cut(s) 32, 373
BstDEI CTNAG 2 cut(s) 20, 361
BstEII GGTNACC 1 cut(s) 196
BstF5I GGATG 3 cut(s) 71, 304, 347
BstKTI GATC 2 cut(s) 90, 321
BstMBI GATC 2 cut(s) 87, 318
BstNI CCWGG 3 cut(s) 56, 82, 329
BstPI GGTNACC 1 cut(s) 196
BstSCI CCNGG 6 cut(s) 54, 74, 80, 95, 96, 327
BstSLI GKGCMC 2 cut(s) 29, 370
Bsu36I CCTNAGG 2 cut(s) 20, 361
BsuRI GGCC 4 cut(s) 27, 79, 282, 368
BtgZI GCGATG 1 cut(s) 348
BtrI CACGTC 1 cut(s) 93
BtsCI GGATG 3 cut(s) 71, 304, 347
BtsIMutI CAGTG 2 cut(s) 197, 271
Cfr13I GGNCC 7 cut(s) 25, 26, 58, 78, 100, 366, 367
Cfr9I CCCGGG 1 cut(s) 96
CviAII CATG 1 cut(s) 206
CviJI RGCY 9 cut(s) 27, 79, 141, 221, 263, 271, 282, 368, 406
CviKI_1 RGCY 9 cut(s) 27, 79, 141, 221, 263, 271, 282, 368, 406
DdeI CTNAG 2 cut(s) 20, 361
DpnI GATC 2 cut(s) 89, 320
DpnII GATC 2 cut(s) 87, 318
DrdI GACNNNNNNGTC 3 cut(s) 37, 65, 378
DseDI GACNNNNNNGTC 3 cut(s) 37, 65, 378
EciI GGCGGA 1 cut(s) 100
Ecl136II GAGCTC 1 cut(s) 271
Eco147I AGGCCT 1 cut(s) 282
Eco24I GRGCYC 3 cut(s) 29, 273, 370
Eco47I GGWCC 2 cut(s) 58, 100
Eco53kI GAGCTC 1 cut(s) 271
Eco81I CCTNAGG 2 cut(s) 20, 361
Eco88I CYCGRG 1 cut(s) 96
Eco91I GGTNACC 1 cut(s) 196
EcoICRI GAGCTC 1 cut(s) 271
EcoO109I RGGNCCY 3 cut(s) 25, 100, 366
EcoO65I GGTNACC 1 cut(s) 196
EcoRII CCWGG 3 cut(s) 54, 80, 327
EcoT38I GRGCYC 3 cut(s) 29, 273, 370
FaeI CATG 1 cut(s) 209
FaiI YATR 2 cut(s) 207, 308
FaqI GGGAC 2 cut(s) 79, 113
FatI CATG 1 cut(s) 205
FauI CCCGC 1 cut(s) 111
FokI GGATG 3 cut(s) 58, 311, 354
FriOI GRGCYC 3 cut(s) 29, 273, 370
FspBI CTAG 1 cut(s) 290
HaeIII GGCC 4 cut(s) 27, 79, 282, 368
HapII CCGG 2 cut(s) 76, 97
Hin1I GRCGYC 2 cut(s) 32, 373
Hin1II CATG 1 cut(s) 209
HpaII CCGG 2 cut(s) 76, 97
HphI GGTGA 1 cut(s) 190
Hpy188I TCNGA 2 cut(s) 242, 410
Hpy188III TCNNGA 1 cut(s) 177
Hpy99I CGWCG 4 cut(s) 34, 43, 375, 384
HpyAV CCTTC 1 cut(s) 235
HpyCH4III ACNGT 2 cut(s) 116, 158
HpyCH4IV ACGT 3 cut(s) 32, 92, 373
HpyF3I CTNAG 2 cut(s) 20, 361
HpySE526I ACGT 3 cut(s) 32, 92, 373
Hsp92I GRCGYC 2 cut(s) 32, 373
Hsp92II CATG 1 cut(s) 209
KflI GGGWCCC 1 cut(s) 100
Kzo9I GATC 2 cut(s) 87, 318
LmnI GCTCC 2 cut(s) 111, 276
MaeI CTAG 1 cut(s) 290
MaeII ACGT 3 cut(s) 32, 92, 373
MaeIII GTNAC 4 cut(s) 3, 67, 196, 344
MalI GATC 2 cut(s) 89, 320
MbiI CCGCTC 1 cut(s) 106
MboI GATC 2 cut(s) 87, 318
MhlI GDGCHC 3 cut(s) 29, 273, 370
MluCI AATT 1 cut(s) 63
MnlI CCTC 5 cut(s) 26, 46, 162, 293, 387
MseI TTAA 2 cut(s) 234, 314
MspI CCGG 2 cut(s) 76, 97
MspR9I CCNGG 6 cut(s) 56, 76, 82, 97, 98, 329
MvaI CCWGG 3 cut(s) 56, 82, 329
NciI CCSGG 3 cut(s) 76, 97, 98
NdeII GATC 2 cut(s) 87, 318
NlaIII CATG 1 cut(s) 209
NlaIV GGNNCC 7 cut(s) 26, 27, 101, 102, 255, 367, 368
NmuCI GTSAC 4 cut(s) 3, 67, 196, 344
PasI CCCWGGG 1 cut(s) 328
PceI AGGCCT 1 cut(s) 282
PpuMI RGGWCCY 1 cut(s) 100
Psp124BI GAGCTC 1 cut(s) 273
Psp5II RGGWCCY 1 cut(s) 100
Psp6I CCWGG 3 cut(s) 54, 80, 327
PspEI GGTNACC 1 cut(s) 196
PspGI CCWGG 3 cut(s) 54, 80, 327
PspN4I GGNNCC 7 cut(s) 26, 27, 101, 102, 255, 367, 368
PspOMI GGGCCC 2 cut(s) 25, 366
PspPI GGNCC 7 cut(s) 25, 26, 58, 78, 100, 366, 367
PspPPI RGGWCCY 1 cut(s) 100
SacI GAGCTC 1 cut(s) 273
SaqAI TTAA 2 cut(s) 234, 314
Sau3AI GATC 2 cut(s) 87, 318
Sau96I GGNCC 7 cut(s) 25, 26, 58, 78, 100, 366, 367
ScrFI CCNGG 6 cut(s) 56, 76, 82, 97, 98, 329
SduI GDGCHC 3 cut(s) 29, 273, 370
SetI ASST 5 cut(s) 35, 95, 273, 295, 376
SinI GGWCC 2 cut(s) 58, 100
SmaI CCCGGG 1 cut(s) 98
Sse9I AATT 1 cut(s) 63
SseBI AGGCCT 1 cut(s) 282
SsiI CCGC 3 cut(s) 85, 104, 132
SspMI CTAG 1 cut(s) 290
SstI GAGCTC 1 cut(s) 273
StuI AGGCCT 1 cut(s) 282
StyD4I CCNGG 6 cut(s) 54, 74, 80, 95, 96, 327
TaaI ACNGT 2 cut(s) 116, 158
TaiI ACGT 3 cut(s) 35, 95, 376
TasI AATT 1 cut(s) 63
Tru1I TTAA 2 cut(s) 234, 314
Tru9I TTAA 2 cut(s) 234, 314
TscAI CASTG 2 cut(s) 197, 271
TseFI GTSAC 4 cut(s) 3, 67, 196, 344
Tsp45I GTSAC 4 cut(s) 3, 67, 196, 344
TspGWI ACGGA 1 cut(s) 266
TspMI CCCGGG 1 cut(s) 96
TspRI CASTG 2 cut(s) 197, 271
VpaK11BI GGWCC 2 cut(s) 58, 100
XmaI CCCGGG 1 cut(s) 96
XspI CTAG 1 cut(s) 290
ZraI GACGTC 2 cut(s) 33, 374
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.