pycom17g16740

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
OG0000158
Physical Location & Seq
Forward (+)
14774068 .. 14775448
1381 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom17g16740.8

Sequence Viewer

Length: 969 bp
ATGAGTCTATCAAGAATGTTGTCAAAATTTCCTAACTTTAGCCCAAAGCATCTGATCGTCGCTGCATTGCAAAGCTTATTTGTGACTTTTGGGCCGGAAGATGATGGATTTTGGGCTTGGTCAGTTTGGGCCTATTTTGGATCCCTGAAGGTCCAAAAACGTGGTTATTGCTTTGCTAGGCAGATTTCCTACCTTGATTTGGATTGTGTTTTTAAGTTATCTTTATATTATTTTTCAACCATTAGGGTTCTCTACGCAACATTGAGAGAACTTAGCAAAGCTTTGGTGAATTTCAAACTTTATACCTACAAGGTGTTTTCAATCATTTTTCTACTTAATGATATTTTCTTTGGTTTTTATAATGATTTTGTAAGATCCCACATCCACGAGGCCTTTTGGGAGTTCACTAGCTTCGGGTTCCATGCGAACTCCAAAGTTAAGCGAGTAGCACGCGAGAGCACTCCCATGATGGGTGACCCACTGGGAAGTTCTCGCGTGAGTTCCCGGAAACAAAACCGTGAGGGTGTGTTGGGGCCCAAAGCAGACAATATTGTGCTACGGTGGAGTCAGGCCCGGGATGACGTCGGGCCCCTAAGGGGGCTGGATTGTAAGATCCCACATCGCCCAGGCGATCGATCCTTATATTTCACTAGCTTCGGGTTCCATAGGAACTCCAAAGTTAAGCGAGTAACGCGTGAGAGCACTCCCATGATGGGTGACCCACTGGGAAGTTCTCGTGTGAGTTCCCAGAAACAAAATCGTGTGGGTGTGCTGGGGCCCAAATGGTCCCGCCTGGGCCAGGATGTGACAATTTCTAGAATCGGTGCCACTATTTCTAGAATTGTTTTTATAAAAATAATTTGCAAAATTCAATTTAATTTGAAGTCATTTGCCTATTTATTTATGACGATGAAATTTCGTTGTTTCTTGTATAACAAAGTGTTCGTCAATTTCTTTGAACTCAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

323

Amino Acids

37.28

Weight (kDa)

10.11

Isoelectric Point (pI)

32.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 360, 851
AatII GACGTC 1 cut(s) 585
AccB1I GGYRCC 1 cut(s) 824
AccII CGCG 3 cut(s) 453, 495, 694
AciI CCGC 1 cut(s) 790
AclWI GGATC 5 cut(s) 135, 148, 369, 607, 630
AcsI RAATTY 4 cut(s) 26, 289, 867, 914
AcuI CTGAAG 1 cut(s) 167
AcyI GRCGYC 1 cut(s) 582
AfiI CCNNNNNNNGG 6 cut(s) 199, 470, 596, 597, 713, 799
AflIII ACRYGT 1 cut(s) 692
AgsI TTSAA 6 cut(s) 237, 295, 321, 872, 883, 959
AjnI CCWGG 3 cut(s) 625, 792, 798
AluBI AGCT 4 cut(s) 75, 281, 411, 654
AluI AGCT 4 cut(s) 75, 281, 411, 654
Alw21I GWGCWC 2 cut(s) 461, 704
AlwI GGATC 5 cut(s) 135, 148, 369, 607, 630
Ama87I CYCGRG 1 cut(s) 573
AoxI GGCC 8 cut(s) 92, 129, 390, 533, 570, 587, 776, 796
ApaI GGGCCC 3 cut(s) 537, 591, 780
ApeKI GCWGC 1 cut(s) 62
ApoI RAATTY 4 cut(s) 26, 289, 867, 914
ArsI GACNNNNNNTTYG 2 cut(s) 930, 962
AsuC2I CCSGG 3 cut(s) 505, 574, 575
AsuHPI GGTGA 3 cut(s) 298, 485, 728
AvaI CYCGRG 1 cut(s) 573
AvaII GGWCC 2 cut(s) 151, 786
AxyI CCTNAGG 1 cut(s) 593
BaeGI GKGCMC 3 cut(s) 537, 591, 780
BamHI GGATCC 1 cut(s) 140
BanI GGYRCC 1 cut(s) 824
BanII GRGCYC 3 cut(s) 537, 591, 780
BauI CACGAG 2 cut(s) 386, 735
Bbv12I GWGCWC 2 cut(s) 461, 704
BbvI GCAGC 1 cut(s) 49
BccI CCATC 3 cut(s) 98, 463, 706
BciT130I CCWGG 3 cut(s) 627, 794, 800
BcnI CCSGG 3 cut(s) 505, 574, 575
BfaI CTAG 5 cut(s) 177, 408, 651, 816, 837
BisI GCNGC 1 cut(s) 63
BlsI GCNGC 1 cut(s) 64
Bme1390I CCNGG 6 cut(s) 505, 574, 575, 627, 794, 800
Bme18I GGWCC 2 cut(s) 151, 786
BmeT110I CYCGRG 1 cut(s) 573
BmrFI CCNGG 6 cut(s) 505, 574, 575, 627, 794, 800
BmrI ACTGGG 2 cut(s) 491, 734
BmsI GCATC 1 cut(s) 58
BmuI ACTGGG 2 cut(s) 491, 734
BpuMI CCSGG 3 cut(s) 505, 574, 575
Bsa29I ATCGAT 1 cut(s) 634
BsaHI GRCGYC 1 cut(s) 582
BsaJI CCNNGG 3 cut(s) 573, 625, 793
Bsc4I CCNNNNNNNGG 6 cut(s) 199, 470, 596, 597, 713, 799
Bse1I ACTGG 2 cut(s) 486, 729
Bse21I CCTNAGG 1 cut(s) 593
Bse3DI GCAATG 1 cut(s) 65
BseBI CCWGG 3 cut(s) 627, 794, 800
BseCI ATCGAT 1 cut(s) 634
BseDI CCNNGG 3 cut(s) 573, 625, 793
BseGI GGATG 3 cut(s) 381, 583, 808
BseLI CCNNNNNNNGG 6 cut(s) 199, 470, 596, 597, 713, 799
BseMI GCAATG 1 cut(s) 65
BseNI ACTGG 2 cut(s) 486, 729
BseSI GKGCMC 3 cut(s) 537, 591, 780
BseXI GCAGC 1 cut(s) 49
BseYI CCCAGC 1 cut(s) 772
Bsh1236I CGCG 3 cut(s) 453, 495, 694
Bsh1285I CGRYCG 1 cut(s) 634
BshFI GGCC 8 cut(s) 94, 131, 392, 535, 572, 589, 778, 798
BshNI GGYRCC 1 cut(s) 824
BshVI ATCGAT 1 cut(s) 634
BsiEI CGRYCG 1 cut(s) 634
BsiHKAI GWGCWC 2 cut(s) 461, 704
BsiHKCI CYCGRG 1 cut(s) 573
BsiSI CCGG 3 cut(s) 95, 505, 574
BslFI GGGAC 1 cut(s) 772
BslI CCNNNNNNNGG 6 cut(s) 199, 470, 596, 597, 713, 799
BsmFI GGGAC 1 cut(s) 772
BsnI GGCC 8 cut(s) 94, 131, 392, 535, 572, 589, 778, 798
BsoBI CYCGRG 1 cut(s) 573
Bsp120I GGGCCC 3 cut(s) 533, 587, 776
Bsp1286I GDGCHC 5 cut(s) 461, 537, 591, 704, 780
Bsp143I GATC 6 cut(s) 54, 140, 374, 612, 631, 635
BspACI CCGC 1 cut(s) 790
BspANI GGCC 8 cut(s) 94, 131, 392, 535, 572, 589, 778, 798
BspDI ATCGAT 1 cut(s) 634
BspFNI CGCG 3 cut(s) 453, 495, 694
BspPI GGATC 5 cut(s) 135, 148, 369, 607, 630
BspT107I GGYRCC 1 cut(s) 824
BsrDI GCAATG 1 cut(s) 65
BsrI ACTGG 2 cut(s) 486, 729
BssECI CCNNGG 3 cut(s) 573, 625, 793
BssMI GATC 6 cut(s) 54, 140, 374, 612, 631, 635
BssNI GRCGYC 1 cut(s) 582
BssSI CACGAG 2 cut(s) 386, 735
Bst2BI CACGAG 2 cut(s) 386, 735
Bst2UI CCWGG 3 cut(s) 627, 794, 800
Bst4CI ACNGT 2 cut(s) 518, 561
BstACI GRCGYC 1 cut(s) 582
BstC8I GCNNGC 1 cut(s) 451
BstDEI CTNAG 2 cut(s) 272, 593
BstEII GGTNACC 2 cut(s) 473, 716
BstENI CCTNNNNNAGG 1 cut(s) 797
BstF5I GGATG 3 cut(s) 381, 583, 808
BstFNI CGCG 3 cut(s) 453, 495, 694
BstKTI GATC 6 cut(s) 57, 143, 377, 615, 634, 638
BstMBI GATC 6 cut(s) 54, 140, 374, 612, 631, 635
BstMCI CGRYCG 1 cut(s) 634
BstMWI GCNNNNNNNGC 1 cut(s) 691
BstNI CCWGG 3 cut(s) 627, 794, 800
BstPI GGTNACC 2 cut(s) 473, 716
BstSCI CCNGG 6 cut(s) 503, 572, 573, 625, 792, 798
BstSLI GKGCMC 3 cut(s) 537, 591, 780
BstUI CGCG 3 cut(s) 453, 495, 694
BstV1I GCAGC 1 cut(s) 49
BstX2I RGATCY 3 cut(s) 140, 374, 612
BstXI CCANNNNNNTGG 1 cut(s) 161
BstYI RGATCY 3 cut(s) 140, 374, 612
Bsu15I ATCGAT 1 cut(s) 634
Bsu36I CCTNAGG 1 cut(s) 593
BsuRI GGCC 8 cut(s) 94, 131, 392, 535, 572, 589, 778, 798
BsuTUI ATCGAT 1 cut(s) 634
BtgZI GCGATG 1 cut(s) 605
BtsCI GGATG 3 cut(s) 381, 583, 808
BtsIMutI CAGTG 2 cut(s) 479, 722
Cac8I GCNNGC 1 cut(s) 451
Cfr9I CCCGGG 1 cut(s) 573
ClaI ATCGAT 1 cut(s) 634
CviAII CATG 3 cut(s) 422, 466, 709
DdeI CTNAG 2 cut(s) 272, 593
DpnI GATC 6 cut(s) 56, 142, 376, 614, 633, 637
DpnII GATC 6 cut(s) 54, 140, 374, 612, 631, 635
Eco147I AGGCCT 1 cut(s) 392
Eco24I GRGCYC 3 cut(s) 537, 591, 780
Eco47I GGWCC 2 cut(s) 151, 786
Eco57I CTGAAG 1 cut(s) 167
Eco81I CCTNAGG 1 cut(s) 593
Eco88I CYCGRG 1 cut(s) 573
Eco91I GGTNACC 2 cut(s) 473, 716
EcoNI CCTNNNNNAGG 1 cut(s) 797
EcoO109I RGGNCCY 3 cut(s) 533, 588, 776
EcoO65I GGTNACC 2 cut(s) 473, 716
EcoRII CCWGG 3 cut(s) 625, 792, 798
EcoT38I GRGCYC 3 cut(s) 537, 591, 780
FaeI CATG 3 cut(s) 425, 469, 712
FaqI GGGAC 1 cut(s) 772
FatI CATG 3 cut(s) 421, 465, 708
FauI CCCGC 1 cut(s) 797
Fnu4HI GCNGC 1 cut(s) 63
FokI GGATG 3 cut(s) 368, 590, 815
FriOI GRGCYC 3 cut(s) 537, 591, 780
Fsp4HI GCNGC 1 cut(s) 63
FspBI CTAG 5 cut(s) 177, 408, 651, 816, 837
GluI GCNGC 1 cut(s) 63
GsaI CCCAGC 1 cut(s) 776
HaeIII GGCC 8 cut(s) 94, 131, 392, 535, 572, 589, 778, 798
HapII CCGG 3 cut(s) 95, 505, 574
Hin1I GRCGYC 1 cut(s) 582
Hin1II CATG 3 cut(s) 425, 469, 712
HindIII AAGCTT 2 cut(s) 73, 279
HinfI GANTC 3 cut(s) 4, 565, 819
HpaII CCGG 3 cut(s) 95, 505, 574
HphI GGTGA 3 cut(s) 298, 485, 728
Hpy166II GTNNAC 1 cut(s) 405
Hpy188I TCNGA 1 cut(s) 54
Hpy188III TCNNGA 3 cut(s) 12, 816, 837
Hpy8I GTNNAC 1 cut(s) 405
Hpy99I CGWCG 2 cut(s) 62, 587
HpyAV CCTTC 1 cut(s) 142
HpyCH4III ACNGT 2 cut(s) 518, 561
HpyCH4IV ACGT 2 cut(s) 160, 582
HpyCH4V TGCA 3 cut(s) 65, 70, 864
HpyF10VI GCNNNNNNNGC 1 cut(s) 691
HpyF3I CTNAG 2 cut(s) 272, 593
HpySE526I ACGT 2 cut(s) 160, 582
Hsp92I GRCGYC 1 cut(s) 582
Hsp92II CATG 3 cut(s) 425, 469, 712
Kzo9I GATC 6 cut(s) 54, 140, 374, 612, 631, 635
Lsp1109I GCAGC 1 cut(s) 49
LweI GCATC 1 cut(s) 58
MaeI CTAG 5 cut(s) 177, 408, 651, 816, 837
MaeII ACGT 2 cut(s) 160, 582
MaeIII GTNAC 5 cut(s) 82, 473, 688, 716, 805
MalI GATC 6 cut(s) 56, 142, 376, 614, 633, 637
MboI GATC 6 cut(s) 54, 140, 374, 612, 631, 635
MboII GAAGA 1 cut(s) 110
MflI RGATCY 3 cut(s) 140, 374, 612
MhlI GDGCHC 5 cut(s) 461, 537, 591, 704, 780
MluI ACGCGT 1 cut(s) 692
MlyI GAGTC 2 cut(s) 13, 574
MnlI CCTC 2 cut(s) 382, 514
MseI TTAA 5 cut(s) 213, 336, 438, 681, 876
MslI CAYNNNNRTG 2 cut(s) 464, 707
MspI CCGG 3 cut(s) 95, 505, 574
MspR9I CCNGG 6 cut(s) 505, 574, 575, 627, 794, 800
MvaI CCWGG 3 cut(s) 627, 794, 800
MvnI CGCG 3 cut(s) 453, 495, 694
MwoI GCNNNNNNNGC 1 cut(s) 691
NciI CCSGG 3 cut(s) 505, 574, 575
NdeII GATC 6 cut(s) 54, 140, 374, 612, 631, 635
NlaIII CATG 3 cut(s) 425, 469, 712
NmuCI GTSAC 4 cut(s) 82, 473, 716, 805
PceI AGGCCT 1 cut(s) 392
PfeI GAWTC 1 cut(s) 819
PfoI TCCNGGA 1 cut(s) 503
PkrI GCNGC 1 cut(s) 64
Ple19I CGATCG 1 cut(s) 634
PleI GAGTC 2 cut(s) 12, 573
PpsI GAGTC 2 cut(s) 12, 573
PsiI TTATAA 2 cut(s) 360, 851
Psp6I CCWGG 3 cut(s) 625, 792, 798
PspEI GGTNACC 2 cut(s) 473, 716
PspFI CCCAGC 1 cut(s) 772
PspGI CCWGG 3 cut(s) 625, 792, 798
PspOMI GGGCCC 3 cut(s) 533, 587, 776
PsuI RGATCY 3 cut(s) 140, 374, 612
PvuI CGATCG 1 cut(s) 634
RseI CAYNNNNRTG 2 cut(s) 464, 707
SaqAI TTAA 5 cut(s) 213, 336, 438, 681, 876
SatI GCNGC 1 cut(s) 63
Sau3AI GATC 6 cut(s) 54, 140, 374, 612, 631, 635
SchI GAGTC 2 cut(s) 13, 574
ScrFI CCNGG 6 cut(s) 505, 574, 575, 627, 794, 800
SduI GDGCHC 5 cut(s) 461, 537, 591, 704, 780
SfaNI GCATC 1 cut(s) 58
SinI GGWCC 2 cut(s) 151, 786
SmaI CCCGGG 1 cut(s) 575
SmiMI CAYNNNNRTG 2 cut(s) 464, 707
SseBI AGGCCT 1 cut(s) 392
SsiI CCGC 1 cut(s) 790
SspI AATATT 1 cut(s) 550
SspMI CTAG 5 cut(s) 177, 408, 651, 816, 837
StuI AGGCCT 1 cut(s) 392
StyD4I CCNGG 6 cut(s) 503, 572, 573, 625, 792, 798
TaaI ACNGT 2 cut(s) 518, 561
TaiI ACGT 2 cut(s) 163, 585
TaqI TCGA 1 cut(s) 634
TfiI GAWTC 1 cut(s) 819
Tru1I TTAA 5 cut(s) 213, 336, 438, 681, 876
Tru9I TTAA 5 cut(s) 213, 336, 438, 681, 876
TscAI CASTG 2 cut(s) 486, 729
TseFI GTSAC 4 cut(s) 82, 473, 716, 805
TseI GCWGC 1 cut(s) 62
Tsp45I GTSAC 4 cut(s) 82, 473, 716, 805
TspDTI ATGAA 1 cut(s) 926
TspMI CCCGGG 1 cut(s) 573
TspRI CASTG 2 cut(s) 486, 729
VpaK11BI GGWCC 2 cut(s) 151, 786
XagI CCTNNNNNAGG 1 cut(s) 797
XapI RAATTY 4 cut(s) 26, 289, 867, 914
XbaI TCTAGA 2 cut(s) 815, 836
XmaI CCCGGG 1 cut(s) 573
XspI CTAG 5 cut(s) 177, 408, 651, 816, 837
ZraI GACGTC 1 cut(s) 583
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.