pycom17g17100

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
Physical Location & Seq
Forward (+)
14964326 .. 14966592
2267 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom17g17100.11

Sequence Viewer

Length: 1554 bp
ATGCCTTGTCAGTGCTTATGGTTTTCACAAAACTTAATAACTTTTGATATGTATCTTTGTTATGCGTTTCATATAAAGAACTTGAAAAAGATAATTTGGTTGGTTAGTTGTGCGATGCAACTAATTTGGGATGTTATGCATATATCACGTGTGGAGAAGGACCCTCTAACTAGCATTTCACCCATTTATTTCACACAAATTCGTTTTTACAAAGTATTTTCTACAAAGTTTTTTCAAAATCTGTTTTCTTTTAGTCTTTTGAGTCAAGTTAAGTTCTATTTTCGTCCAAATCACTTGTTAGGTCTAGAATTGAGTCTTTTTTATTTAGCATCCTTAGTTAATCCTCGGTCTACAACGATCCCTACTTACATATCTACTACAATTCAGCTTCTTGCTCATCATCCACACTCTGAGGATAAAATTGGCTGCGGAATTAATTTTATCATGCTCAATGATAGCACTCGTGGACCACCAGTCTTTCCTTCAGTAGGTTGCTCCCGACAGCTCCACCACCAATGGAATCGGGGGACTCGGACTGTTATCACCACTCAACCCGAGCGACGTCGGCGTTGCAGGCTCATCGGAGGCAGCTCATCTGAAATTTCTGGCCACACCGTACATGTCGTATGGCCACGACAAAGGAGGGCAATATTGGCATCTTCCACAATAAGCCATTTTTTGAAGCTGTTTTTTGTACTGATTTGGGGTGTTTACCAAATACCAAAAACTCTCCTAGCTTTTTTTTCATACCAGTTTTTTTTAAAATCACCTCAACCCCAAACCATACCTAATAACACCATTTTTAGTTTCAAAAGGTCAAAGCATTTAAAAATAAATAAAAGCCAAATGACTTTTGAGAAGTCAGACATGAATTCCAACATGAAAAAGGATCTTCATCGGATTCTTTTCTTAGAGATCCTAAAGATCATCATTTTAAAATTAAATATAAATAAATCCCTAAGATCCCCAGGAAAAGGATCCGGCGAGGATCCTTTTCCTTCCAATCTAGTCCCATTTACTTCTTCACTTTACCAAATTCTGATATCTAATTGGTTATCCACCATTTCCCACCCCACCCAACCCAACCACGGAAGCCAATGGCTACAAACATGGGGCCCTCTAAAAGTTATAATAATTGTAGCTGTTGAATCAAATTTCAACGGCCCAGATCCTTTGCTCAGGAGACTCAGTTTATTTGGGTTTGGAGGGGATCCGATTCCACTGAAGGCCACCATCAGTAGTGCGAGAGATTTTTCAGTATGCCCGAAATACAGGGCGGAACACCACGTGTCATTATACAATTGGAATAACGTGATATTTCCCTGTGTTCCGGATCCACTGAAATATCTCTTTAGTAATGCAGCACCAGACTCCCTCTCCACGTACCAGACCGGACCAAGTTCACCAACTAATTCTAAATTAATTATACATATATTTTTTCTTATATTGACAATGAAACTATCTGAAAGCTTGTTGTGGACAAATTTAGTAGCTTGTAATGTTGTTTGCACAAAGATTATGAGTGAAAATTTTTTTGAAGCTTTTATATTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

518

Amino Acids

59.37

Weight (kDa)

9.75

Isoelectric Point (pI)

46.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 1130, 1552
AatII GACGTC 1 cut(s) 565
AccI GTMKAC 1 cut(s) 350
AccIII TCCGGA 1 cut(s) 1330
AciI CCGC 2 cut(s) 429, 1277
AcoI YGGCCR 2 cut(s) 607, 629
AcsI RAATTY 7 cut(s) 198, 600, 871, 1035, 1153, 1483, 1528
AcuI CTGAAG 2 cut(s) 468, 1244
AcvI CACGTG 2 cut(s) 149, 1288
AcyI GRCGYC 1 cut(s) 562
AdeI CACNNNGTG 1 cut(s) 1288
AfaI GTAC 3 cut(s) 618, 696, 1385
AfiI CCNNNNNNNGG 3 cut(s) 488, 974, 1088
AflIII ACRYGT 3 cut(s) 148, 619, 1287
AgsI TTSAA 7 cut(s) 85, 236, 682, 811, 1148, 1159, 1538
AhdI GACNNNNNGTC 1 cut(s) 473
AjnI CCWGG 1 cut(s) 967
AluBI AGCT 9 cut(s) 388, 505, 591, 685, 737, 1142, 1470, 1493, 1541
AluI AGCT 9 cut(s) 388, 505, 591, 685, 737, 1142, 1470, 1493, 1541
Alw26I GTCTC 1 cut(s) 1177
Ama87I CYCGRG 1 cut(s) 554
Aor13HI TCCGGA 1 cut(s) 1330
AoxI GGCC 5 cut(s) 607, 629, 1114, 1162, 1227
ApaI GGGCCC 1 cut(s) 1118
ApeKI GCWGC 3 cut(s) 426, 588, 1361
ApoI RAATTY 7 cut(s) 198, 600, 871, 1035, 1153, 1483, 1528
AseI ATTAAT 2 cut(s) 435, 1421
AspS9I GGNCC 6 cut(s) 160, 467, 1114, 1115, 1163, 1394
AsuHPI GGTGA 4 cut(s) 171, 535, 759, 1395
AvaI CYCGRG 1 cut(s) 554
AvaII GGWCC 3 cut(s) 160, 467, 1394
BaeGI GKGCMC 1 cut(s) 1118
BalI TGGCCA 2 cut(s) 609, 631
BamHI GGATCC 4 cut(s) 977, 988, 1210, 1333
BanII GRGCYC 1 cut(s) 1118
BauI CACGAG 1 cut(s) 462
BbrPI CACGTG 2 cut(s) 149, 1288
BbvI GCAGC 3 cut(s) 413, 600, 1373
BccI CCATC 1 cut(s) 1241
BceAI ACGGC 1 cut(s) 1177
BcgI CGANNNNNNTGC 2 cut(s) 562, 596
BciT130I CCWGG 1 cut(s) 969
BcoDI GTCTC 1 cut(s) 1177
BfaI CTAG 4 cut(s) 171, 305, 734, 1007
BisI GCNGC 3 cut(s) 427, 589, 1362
BlsI GCNGC 3 cut(s) 428, 590, 1363
Bme1390I CCNGG 1 cut(s) 969
Bme18I GGWCC 3 cut(s) 160, 467, 1394
BmeRI GACNNNNNGTC 1 cut(s) 473
BmeT110I CYCGRG 1 cut(s) 554
BmgT120I GGNCC 6 cut(s) 160, 467, 1114, 1115, 1163, 1394
BmiI GGNNCC 7 cut(s) 162, 979, 990, 1115, 1116, 1212, 1335
BmrFI CCNGG 1 cut(s) 969
BmsI GCATC 3 cut(s) 105, 338, 665
Bpu10I CCTNAGC 1 cut(s) 1178
BsaAI YACGTR 3 cut(s) 149, 1288, 1383
BsaBI GATNNNNATC 2 cut(s) 51, 894
BsaHI GRCGYC 1 cut(s) 562
BsaJI CCNNGG 3 cut(s) 344, 967, 1087
BsaWI WCCGGW 2 cut(s) 1330, 1391
BsaXI ACNNNNNCTCC 4 cut(s) 1174, 1204, 1361, 1391
Bsc4I CCNNNNNNNGG 3 cut(s) 488, 974, 1088
Bse1I ACTGG 2 cut(s) 473, 751
Bse8I GATNNNNATC 2 cut(s) 51, 894
BseAI TCCGGA 1 cut(s) 1330
BseBI CCWGG 1 cut(s) 969
BseDI CCNNGG 3 cut(s) 344, 967, 1087
BseGI GGATG 3 cut(s) 136, 329, 400
BseJI GATNNNNATC 2 cut(s) 51, 894
BseLI CCNNNNNNNGG 3 cut(s) 488, 974, 1088
BseMII CTCAG 3 cut(s) 402, 1192, 1201
BseNI ACTGG 2 cut(s) 473, 751
BseSI GKGCMC 1 cut(s) 1118
BseXI GCAGC 3 cut(s) 413, 600, 1373
BshFI GGCC 5 cut(s) 609, 631, 1116, 1164, 1229
BsiHKCI CYCGRG 1 cut(s) 554
BsiSI CCGG 3 cut(s) 981, 1331, 1392
BslFI GGGAC 2 cut(s) 541, 995
BslI CCNNNNNNNGG 3 cut(s) 488, 974, 1088
BsmAI GTCTC 1 cut(s) 1177
BsmFI GGGAC 2 cut(s) 541, 995
BsnI GGCC 5 cut(s) 609, 631, 1116, 1164, 1229
BsoBI CYCGRG 1 cut(s) 554
Bsp120I GGGCCC 1 cut(s) 1114
Bsp1286I GDGCHC 1 cut(s) 1118
Bsp13I TCCGGA 1 cut(s) 1330
BspACI CCGC 2 cut(s) 429, 1277
BspANI GGCC 5 cut(s) 609, 631, 1116, 1164, 1229
BspCNI CTCAG 3 cut(s) 403, 1191, 1200
BspEI TCCGGA 1 cut(s) 1330
BspLI GGNNCC 7 cut(s) 162, 979, 990, 1115, 1116, 1212, 1335
BsrI ACTGG 2 cut(s) 473, 751
BssECI CCNNGG 3 cut(s) 344, 967, 1087
BssNI GRCGYC 1 cut(s) 562
BssSI CACGAG 1 cut(s) 462
Bst2BI CACGAG 1 cut(s) 462
Bst2UI CCWGG 1 cut(s) 969
Bst4CI ACNGT 2 cut(s) 538, 616
BstACI GRCGYC 1 cut(s) 562
BstBAI YACGTR 3 cut(s) 149, 1288, 1383
BstC8I GCNNGC 1 cut(s) 575
BstDEI CTNAG 6 cut(s) 334, 411, 910, 959, 1178, 1187
BstDSI CCRYGG 1 cut(s) 1087
BstENI CCTNNNNNAGG 1 cut(s) 486
BstF5I GGATG 3 cut(s) 136, 329, 400
BstMAI GTCTC 1 cut(s) 1177
BstMWI GCNNNNNNNGC 3 cut(s) 565, 574, 653
BstNI CCWGG 1 cut(s) 969
BstNSI RCATGY 1 cut(s) 623
BstSCI CCNGG 1 cut(s) 967
BstSLI GKGCMC 1 cut(s) 1118
BstV1I GCAGC 3 cut(s) 413, 600, 1373
BstX2I RGATCY 8 cut(s) 889, 915, 962, 977, 988, 1168, 1210, 1333
BstYI RGATCY 8 cut(s) 889, 915, 962, 977, 988, 1168, 1210, 1333
BsuRI GGCC 5 cut(s) 609, 631, 1116, 1164, 1229
BtgI CCRYGG 1 cut(s) 1087
BtgZI GCGATG 1 cut(s) 128
BtsCI GGATG 3 cut(s) 136, 329, 400
BtsIMutI CAGTG 3 cut(s) 17, 1220, 1337
Cac8I GCNNGC 1 cut(s) 575
Cfr13I GGNCC 6 cut(s) 160, 467, 1114, 1115, 1163, 1394
Csp6I GTAC 3 cut(s) 617, 695, 1384
CviAII CATG 5 cut(s) 445, 620, 868, 880, 1110
CviQI GTAC 3 cut(s) 617, 695, 1384
DdeI CTNAG 6 cut(s) 334, 411, 910, 959, 1178, 1187
DraI TTTAAA 3 cut(s) 762, 828, 936
DraIII CACNNNGTG 1 cut(s) 1288
DriI GACNNNNNGTC 1 cut(s) 473
EaeI YGGCCR 2 cut(s) 607, 629
Eam1105I GACNNNNNGTC 1 cut(s) 473
EciI GGCGGA 1 cut(s) 1292
Eco24I GRGCYC 1 cut(s) 1118
Eco32I GATATC 1 cut(s) 1044
Eco47I GGWCC 3 cut(s) 160, 467, 1394
Eco57I CTGAAG 2 cut(s) 468, 1244
Eco72I CACGTG 2 cut(s) 149, 1288
Eco88I CYCGRG 1 cut(s) 554
EcoNI CCTNNNNNAGG 1 cut(s) 486
EcoO109I RGGNCCY 3 cut(s) 160, 1114, 1115
EcoRI GAATTC 1 cut(s) 871
EcoRII CCWGG 1 cut(s) 967
EcoRV GATATC 1 cut(s) 1044
EcoT22I ATGCAT 1 cut(s) 141
EcoT38I GRGCYC 1 cut(s) 1118
FaeI CATG 5 cut(s) 448, 623, 871, 883, 1113
FaqI GGGAC 2 cut(s) 541, 995
FatI CATG 5 cut(s) 444, 619, 867, 879, 1109
FblI GTMKAC 1 cut(s) 350
Fnu4HI GCNGC 3 cut(s) 427, 589, 1362
FokI GGATG 3 cut(s) 143, 316, 387
FriOI GRGCYC 1 cut(s) 1118
Fsp4HI GCNGC 3 cut(s) 427, 589, 1362
FspBI CTAG 4 cut(s) 171, 305, 734, 1007
GluI GCNGC 3 cut(s) 427, 589, 1362
HaeIII GGCC 5 cut(s) 609, 631, 1116, 1164, 1229
HapII CCGG 3 cut(s) 981, 1331, 1392
Hin1I GRCGYC 1 cut(s) 562
Hin1II CATG 5 cut(s) 448, 623, 871, 883, 1113
HindIII AAGCTT 2 cut(s) 1468, 1539
HinfI GANTC 9 cut(s) 262, 313, 520, 529, 901, 1148, 1185, 1216, 1370
HpaII CCGG 3 cut(s) 981, 1331, 1392
HphI GGTGA 4 cut(s) 171, 535, 759, 1395
Hpy166II GTNNAC 5 cut(s) 351, 467, 712, 1403, 1479
Hpy188I TCNGA 9 cut(s) 412, 534, 584, 598, 865, 900, 1041, 1215, 1465
Hpy188III TCNNGA 4 cut(s) 305, 498, 1180, 1331
Hpy8I GTNNAC 5 cut(s) 351, 467, 712, 1403, 1479
Hpy99I CGWCG 2 cut(s) 564, 567
HpyAV CCTTC 4 cut(s) 151, 492, 1008, 1219
HpyCH4III ACNGT 2 cut(s) 538, 616
HpyCH4IV ACGT 5 cut(s) 148, 562, 1287, 1311, 1382
HpyCH4V TGCA 5 cut(s) 118, 139, 573, 1361, 1509
HpyF10VI GCNNNNNNNGC 3 cut(s) 565, 574, 653
HpyF3I CTNAG 6 cut(s) 334, 411, 910, 959, 1178, 1187
HpySE526I ACGT 5 cut(s) 148, 562, 1287, 1311, 1382
Hsp92I GRCGYC 1 cut(s) 562
Hsp92II CATG 5 cut(s) 448, 623, 871, 883, 1113
Kpn2I TCCGGA 1 cut(s) 1330
LmnI GCTCC 2 cut(s) 500, 510
Lsp1109I GCAGC 3 cut(s) 413, 600, 1373
LweI GCATC 3 cut(s) 105, 338, 665
MaeI CTAG 4 cut(s) 171, 305, 734, 1007
MaeII ACGT 5 cut(s) 148, 562, 1287, 1311, 1382
MboII GAAGA 3 cut(s) 651, 884, 1014
MfeI CAATTG 1 cut(s) 1300
MflI RGATCY 8 cut(s) 889, 915, 962, 977, 988, 1168, 1210, 1333
MhlI GDGCHC 1 cut(s) 1118
MlsI TGGCCA 2 cut(s) 609, 631
MluNI TGGCCA 2 cut(s) 609, 631
MlyI GAGTC 5 cut(s) 271, 322, 523, 1179, 1364
MmeI TCCRAC 1 cut(s) 900
Mox20I TGGCCA 2 cut(s) 609, 631
Mph1103I ATGCAT 1 cut(s) 141
MroI TCCGGA 1 cut(s) 1330
MscI TGGCCA 2 cut(s) 609, 631
MseI TTAA 9 cut(s) 35, 270, 339, 435, 761, 827, 935, 941, 1421
Msp20I TGGCCA 2 cut(s) 609, 631
MspI CCGG 3 cut(s) 981, 1331, 1392
MspR9I CCNGG 1 cut(s) 969
MunI CAATTG 1 cut(s) 1300
MvaI CCWGG 1 cut(s) 969
MwoI GCNNNNNNNGC 3 cut(s) 565, 574, 653
NlaIII CATG 5 cut(s) 448, 623, 871, 883, 1113
NlaIV GGNNCC 7 cut(s) 162, 979, 990, 1115, 1116, 1212, 1335
NsiI ATGCAT 1 cut(s) 141
NspI RCATGY 1 cut(s) 623
PciI ACATGT 1 cut(s) 619
PfeI GAWTC 4 cut(s) 520, 901, 1148, 1216
PkrI GCNGC 3 cut(s) 428, 590, 1363
PleI GAGTC 5 cut(s) 270, 321, 523, 1179, 1364
PmaCI CACGTG 2 cut(s) 149, 1288
PmlI CACGTG 2 cut(s) 149, 1288
PpsI GAGTC 5 cut(s) 270, 321, 523, 1179, 1364
Ppu21I YACGTR 3 cut(s) 149, 1288, 1383
PpuMI RGGWCCY 1 cut(s) 160
PscI ACATGT 1 cut(s) 619
PshBI ATTAAT 2 cut(s) 435, 1421
PsiI TTATAA 2 cut(s) 1130, 1552
Psp5II RGGWCCY 1 cut(s) 160
Psp6I CCWGG 1 cut(s) 967
PspCI CACGTG 2 cut(s) 149, 1288
PspGI CCWGG 1 cut(s) 967
PspN4I GGNNCC 7 cut(s) 162, 979, 990, 1115, 1116, 1212, 1335
PspOMI GGGCCC 1 cut(s) 1114
PspPI GGNCC 6 cut(s) 160, 467, 1114, 1115, 1163, 1394
PspPPI RGGWCCY 1 cut(s) 160
PsuI RGATCY 8 cut(s) 889, 915, 962, 977, 988, 1168, 1210, 1333
RsaI GTAC 3 cut(s) 618, 696, 1385
RsaNI GTAC 3 cut(s) 617, 695, 1384
SaqAI TTAA 9 cut(s) 35, 270, 339, 435, 761, 827, 935, 941, 1421
SatI GCNGC 3 cut(s) 427, 589, 1362
Sau96I GGNCC 6 cut(s) 160, 467, 1114, 1115, 1163, 1394
SchI GAGTC 5 cut(s) 271, 322, 523, 1179, 1364
ScrFI CCNGG 1 cut(s) 969
SduI GDGCHC 1 cut(s) 1118
SfaNI GCATC 3 cut(s) 105, 338, 665
SinI GGWCC 3 cut(s) 160, 467, 1394
SsiI CCGC 2 cut(s) 429, 1277
SspI AATATT 1 cut(s) 651
SspMI CTAG 4 cut(s) 171, 305, 734, 1007
StyD4I CCNGG 1 cut(s) 967
TaaI ACNGT 2 cut(s) 538, 616
TaiI ACGT 5 cut(s) 151, 565, 1290, 1314, 1385
TaqII GACCGA 1 cut(s) 336
TatI WGTACW 1 cut(s) 694
TfiI GAWTC 4 cut(s) 520, 901, 1148, 1216
Tru1I TTAA 9 cut(s) 35, 270, 339, 435, 761, 827, 935, 941, 1421
Tru9I TTAA 9 cut(s) 35, 270, 339, 435, 761, 827, 935, 941, 1421
TscAI CASTG 3 cut(s) 17, 1227, 1344
TseI GCWGC 3 cut(s) 426, 588, 1361
TspDTI ATGAA 6 cut(s) 59, 735, 884, 884, 896, 1469
TspGWI ACGGA 1 cut(s) 1104
TspRI CASTG 3 cut(s) 17, 1227, 1344
VpaK11BI GGWCC 3 cut(s) 160, 467, 1394
VspI ATTAAT 2 cut(s) 435, 1421
XagI CCTNNNNNAGG 1 cut(s) 486
XapI RAATTY 7 cut(s) 198, 600, 871, 1035, 1153, 1483, 1528
XbaI TCTAGA 1 cut(s) 304
XceI RCATGY 1 cut(s) 623
XmiI GTMKAC 1 cut(s) 350
XspI CTAG 4 cut(s) 171, 305, 734, 1007
ZraI GACGTC 1 cut(s) 563
Zsp2I ATGCAT 1 cut(s) 141
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.