pycom05g23890

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr5
OG0000158
Physical Location & Seq
Forward (+)
25574479 .. 25575904
1426 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom05g23890.8

Sequence Viewer

Length: 1065 bp
ATGTACTGTATTTTCAACGTACTAAAAATTTCTCATAGCATGCGTACGTTGTCTCTTCCCCTGCACTGCACACCATTGTACACCTCACAGGGCCATGTTTCAATGGATGCATGGTTTTACGAACATCATCACCTTCCAATCTCAAACCCGAGAACGATGATTGGCTTTGCAATTTTTCCCATTAGTCTAGTTATTCGTTCAGTCTACAATTCGGTTGGACTTGCCAAAGATTATTTGGCTTCGAACTTAAAAAAGTTTTGTGAGTTTTTGAACATTGAAGATAATAAAAATAAAAAACCGTTGGCTTTGAGATCTAAGGTTTTATGTTTCACATCCTGGCCCGGGACGGATCACTTCCCAGGCCCGCTCCACCACCGTAGCACGATATTGTCCGCTTTGGGCTTACCATTCCCTCACGGTTTTATTTTTGGGAACTCACGAGCAACTTCCCAGTGGGTCACCCATCATGGGATTGCTCTAGCCTCATTCTCGCTTAACTTCGGAGCTCCTACAGAACTTGAAGCTAGTGAGCTCCCAAAAGGCCTCGTGCTAGGTAGGGATGAGAATATACATATAAGGATCACTCCCCTGGGCGATGTGGGATGTCACAATCCACCCCCCTTAGGGGTCCGACGTCCTCCCCGGCCCGGGACGGATCACTTCCCGGGCCCGCTCCACCACCGTAGCACAATATTGTCTGCTTTGGGCTTACCATTCCCTCACGGTTTTATTTTTGGGAACTCACGAGCAACTTCCCAGTGGGTCACCCATCATGGGATTGCTCTAGCCTCCTTCTCTCTTAACTTCGGAGTTCCTACAGAACCCGAAGCCAGTGAGCTCCCAAAAGCACTCCCCTGGGCGATGTGGGATGTCACATTATGTCTAATAGTTAAAAACACTAGGAAATGTGTCAGATTCAACTTTAAAATTCGGAGATTTTGGACCTTGAAGCTTTTCTTAGGGAATAAAATAAATATCGGAATCCTTCTTTTCCTATTTAAACATAGCGTTTTTTTTGTTAGGGAAAACTTAAAATTGCAAATTAATCCAAATAATAACAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

355

Amino Acids

39.85

Weight (kDa)

9.86

Isoelectric Point (pI)

39.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 637
AccBSI CCGCTC 2 cut(s) 367, 673
AccI GTMKAC 1 cut(s) 204
AciI CCGC 3 cut(s) 365, 393, 671
AclWI GGATC 3 cut(s) 357, 587, 663
AcsI RAATTY 2 cut(s) 27, 927
AcyI GRCGYC 1 cut(s) 634
AfaI GTAC 4 cut(s) 5, 21, 46, 80
AfiI CCNNNNNNNGG 8 cut(s) 342, 468, 623, 624, 625, 647, 648, 774
AgsI TTSAA 7 cut(s) 16, 102, 271, 278, 521, 919, 949
AjnI CCWGG 4 cut(s) 335, 358, 588, 854
AluBI AGCT 5 cut(s) 506, 524, 532, 838, 952
AluI AGCT 5 cut(s) 506, 524, 532, 838, 952
Alw21I GWGCWC 3 cut(s) 508, 534, 840
Alw26I GTCTC 1 cut(s) 57
AlwI GGATC 3 cut(s) 357, 587, 663
Ama87I CYCGRG 4 cut(s) 148, 341, 647, 664
AoxI GGCC 6 cut(s) 91, 338, 361, 541, 644, 667
ApaI GGGCCC 1 cut(s) 671
ApoI RAATTY 2 cut(s) 27, 927
AseI ATTAAT 1 cut(s) 1044
Asp700I GAANNNNTTC 1 cut(s) 953
AspS9I GGNCC 8 cut(s) 91, 339, 362, 628, 645, 667, 668, 942
AsuC2I CCSGG 7 cut(s) 342, 343, 643, 648, 649, 665, 666
AsuHPI GGTGA 3 cut(s) 122, 451, 757
AsuII TTCGAA 1 cut(s) 242
AvaI CYCGRG 4 cut(s) 148, 341, 647, 664
AvaII GGWCC 2 cut(s) 628, 942
AxyI CCTNAGG 1 cut(s) 622
BaeGI GKGCMC 1 cut(s) 671
BanII GRGCYC 4 cut(s) 508, 534, 671, 840
BauI CACGAG 3 cut(s) 438, 545, 744
Bbv12I GWGCWC 3 cut(s) 508, 534, 840
BccI CCATC 2 cut(s) 471, 777
BciT130I CCWGG 4 cut(s) 337, 360, 590, 856
BcnI CCSGG 7 cut(s) 342, 343, 643, 648, 649, 665, 666
BcoDI GTCTC 1 cut(s) 57
BfaI CTAG 6 cut(s) 188, 479, 525, 551, 785, 900
BfmI CTRYAG 2 cut(s) 510, 816
BglII AGATCT 1 cut(s) 311
Bme18I GGWCC 2 cut(s) 628, 942
BmeT110I CYCGRG 4 cut(s) 148, 341, 647, 664
BmgT120I GGNCC 8 cut(s) 91, 339, 362, 628, 645, 667, 668, 942
BmiI GGNNCC 2 cut(s) 629, 669
BmrI ACTGGG 2 cut(s) 445, 751
BmsI GCATC 1 cut(s) 97
BmuI ACTGGG 2 cut(s) 445, 751
Bpu14I TTCGAA 1 cut(s) 242
BpuMI CCSGG 7 cut(s) 342, 343, 643, 648, 649, 665, 666
BsaHI GRCGYC 1 cut(s) 634
BsaJI CCNNGG 9 cut(s) 341, 358, 588, 589, 641, 647, 664, 854, 855
Bsc4I CCNNNNNNNGG 8 cut(s) 342, 468, 623, 624, 625, 647, 648, 774
Bse1I ACTGG 3 cut(s) 451, 757, 831
Bse21I CCTNAGG 1 cut(s) 622
BseBI CCWGG 4 cut(s) 337, 360, 590, 856
BseDI CCNNGG 9 cut(s) 341, 358, 588, 589, 641, 647, 664, 854, 855
BseGI GGATG 5 cut(s) 112, 332, 565, 608, 874
BseLI CCNNNNNNNGG 8 cut(s) 342, 468, 623, 624, 625, 647, 648, 774
BseNI ACTGG 3 cut(s) 451, 757, 831
BseSI GKGCMC 1 cut(s) 671
BsgI GTGCAG 2 cut(s) 47, 52
BshFI GGCC 6 cut(s) 93, 340, 363, 543, 646, 669
BsiHKAI GWGCWC 3 cut(s) 508, 534, 840
BsiHKCI CYCGRG 4 cut(s) 148, 341, 647, 664
BsiSI CCGG 4 cut(s) 342, 643, 648, 665
BsiWI CGTACG 1 cut(s) 44
BslFI GGGAC 2 cut(s) 358, 664
BslI CCNNNNNNNGG 8 cut(s) 342, 468, 623, 624, 625, 647, 648, 774
BsmAI GTCTC 1 cut(s) 57
BsmFI GGGAC 2 cut(s) 358, 664
BsnI GGCC 6 cut(s) 93, 340, 363, 543, 646, 669
BsoBI CYCGRG 4 cut(s) 148, 341, 647, 664
Bsp119I TTCGAA 1 cut(s) 242
Bsp120I GGGCCC 1 cut(s) 667
Bsp1286I GDGCHC 4 cut(s) 508, 534, 671, 840
Bsp1407I TGTACA 1 cut(s) 78
Bsp143I GATC 4 cut(s) 311, 349, 579, 655
BspACI CCGC 3 cut(s) 365, 393, 671
BspANI GGCC 6 cut(s) 93, 340, 363, 543, 646, 669
BspLI GGNNCC 2 cut(s) 629, 669
BspPI GGATC 3 cut(s) 357, 587, 663
BspT104I TTCGAA 1 cut(s) 242
BsrBI CCGCTC 2 cut(s) 367, 673
BsrGI TGTACA 1 cut(s) 78
BsrI ACTGG 3 cut(s) 451, 757, 831
BssECI CCNNGG 9 cut(s) 341, 358, 588, 589, 641, 647, 664, 854, 855
BssMI GATC 4 cut(s) 311, 349, 579, 655
BssNI GRCGYC 1 cut(s) 634
BssSI CACGAG 3 cut(s) 438, 545, 744
Bst2BI CACGAG 3 cut(s) 438, 545, 744
Bst2UI CCWGG 4 cut(s) 337, 360, 590, 856
Bst4CI ACNGT 6 cut(s) 8, 300, 377, 419, 683, 725
Bst6I CTCTTC 1 cut(s) 60
BstACI GRCGYC 1 cut(s) 634
BstAUI TGTACA 1 cut(s) 78
BstBI TTCGAA 1 cut(s) 242
BstC8I GCNNGC 3 cut(s) 41, 365, 671
BstDEI CTNAG 3 cut(s) 315, 622, 958
BstEII GGTNACC 2 cut(s) 457, 763
BstF5I GGATG 5 cut(s) 112, 332, 565, 608, 874
BstKTI GATC 4 cut(s) 314, 352, 582, 658
BstMAI GTCTC 1 cut(s) 57
BstMBI GATC 4 cut(s) 311, 349, 579, 655
BstNI CCWGG 4 cut(s) 337, 360, 590, 856
BstNSI RCATGY 1 cut(s) 43
BstPI GGTNACC 2 cut(s) 457, 763
BstSFI CTRYAG 2 cut(s) 510, 816
BstSLI GKGCMC 1 cut(s) 671
BstX2I RGATCY 1 cut(s) 311
BstYI RGATCY 1 cut(s) 311
Bsu36I CCTNAGG 1 cut(s) 622
BsuRI GGCC 6 cut(s) 93, 340, 363, 543, 646, 669
BtgZI GCGATG 2 cut(s) 609, 875
BtsCI GGATG 5 cut(s) 112, 332, 565, 608, 874
BtsI GCAGTG 1 cut(s) 64
BtsIMutI CAGTG 4 cut(s) 64, 458, 764, 838
Cac8I GCNNGC 3 cut(s) 41, 365, 671
Cfr13I GGNCC 8 cut(s) 91, 339, 362, 628, 645, 667, 668, 942
Cfr9I CCCGGG 3 cut(s) 341, 647, 664
Csp6I GTAC 4 cut(s) 4, 20, 45, 79
CviAII CATG 5 cut(s) 40, 95, 111, 467, 773
CviQI GTAC 4 cut(s) 4, 20, 45, 79
DdeI CTNAG 3 cut(s) 315, 622, 958
DpnI GATC 4 cut(s) 313, 351, 581, 657
DpnII GATC 4 cut(s) 311, 349, 579, 655
DraI TTTAAA 2 cut(s) 925, 1000
Eam1104I CTCTTC 1 cut(s) 60
EarI CTCTTC 1 cut(s) 60
Ecl136II GAGCTC 3 cut(s) 506, 532, 838
Eco147I AGGCCT 1 cut(s) 543
Eco24I GRGCYC 4 cut(s) 508, 534, 671, 840
Eco47I GGWCC 2 cut(s) 628, 942
Eco53kI GAGCTC 3 cut(s) 506, 532, 838
Eco81I CCTNAGG 1 cut(s) 622
Eco88I CYCGRG 4 cut(s) 148, 341, 647, 664
Eco91I GGTNACC 2 cut(s) 457, 763
EcoICRI GAGCTC 3 cut(s) 506, 532, 838
EcoO65I GGTNACC 2 cut(s) 457, 763
EcoRII CCWGG 4 cut(s) 335, 358, 588, 854
EcoT22I ATGCAT 1 cut(s) 112
EcoT38I GRGCYC 4 cut(s) 508, 534, 671, 840
FaeI CATG 5 cut(s) 43, 98, 114, 470, 776
FalI AAGNNNNNCTT 2 cut(s) 941, 973
FaqI GGGAC 2 cut(s) 358, 664
FatI CATG 5 cut(s) 39, 94, 110, 466, 772
FauI CCCGC 2 cut(s) 372, 678
FblI GTMKAC 1 cut(s) 204
FokI GGATG 5 cut(s) 119, 319, 572, 615, 881
FriOI GRGCYC 4 cut(s) 508, 534, 671, 840
FspBI CTAG 6 cut(s) 188, 479, 525, 551, 785, 900
HaeIII GGCC 6 cut(s) 93, 340, 363, 543, 646, 669
HapII CCGG 4 cut(s) 342, 643, 648, 665
Hin1I GRCGYC 1 cut(s) 634
Hin1II CATG 5 cut(s) 43, 98, 114, 470, 776
HindIII AAGCTT 1 cut(s) 950
HinfI GANTC 2 cut(s) 915, 981
HpaII CCGG 4 cut(s) 342, 643, 648, 665
HphI GGTGA 3 cut(s) 122, 451, 757
Hpy166II GTNNAC 2 cut(s) 81, 205
Hpy188I TCNGA 6 cut(s) 503, 632, 809, 914, 933, 980
Hpy188III TCNNGA 2 cut(s) 438, 744
Hpy8I GTNNAC 2 cut(s) 81, 205
Hpy99I CGWCG 1 cut(s) 636
HpyAV CCTTC 3 cut(s) 143, 802, 995
HpyCH4III ACNGT 6 cut(s) 8, 300, 377, 419, 683, 725
HpyCH4IV ACGT 3 cut(s) 18, 47, 634
HpyCH4V TGCA 5 cut(s) 64, 69, 110, 170, 1039
HpyF3I CTNAG 3 cut(s) 315, 622, 958
HpySE526I ACGT 3 cut(s) 18, 47, 634
Hsp92I GRCGYC 1 cut(s) 634
Hsp92II CATG 5 cut(s) 43, 98, 114, 470, 776
Kzo9I GATC 4 cut(s) 311, 349, 579, 655
LmnI GCTCC 6 cut(s) 372, 503, 511, 537, 678, 843
LweI GCATC 1 cut(s) 97
MaeI CTAG 6 cut(s) 188, 479, 525, 551, 785, 900
MaeII ACGT 3 cut(s) 18, 47, 634
MaeIII GTNAC 4 cut(s) 457, 605, 763, 871
MalI GATC 4 cut(s) 313, 351, 581, 657
MbiI CCGCTC 2 cut(s) 367, 673
MboI GATC 4 cut(s) 311, 349, 579, 655
MboII GAAGA 2 cut(s) 47, 290
MflI RGATCY 1 cut(s) 311
MhlI GDGCHC 4 cut(s) 508, 534, 671, 840
MluCI AATT 6 cut(s) 27, 171, 208, 927, 1034, 1041
MmeI TCCRAC 2 cut(s) 196, 655
MnlI CCTC 7 cut(s) 94, 423, 493, 554, 648, 729, 799
Mph1103I ATGCAT 1 cut(s) 112
MroXI GAANNNNTTC 1 cut(s) 953
MseI TTAA 8 cut(s) 248, 495, 801, 891, 924, 999, 1031, 1044
MspI CCGG 4 cut(s) 342, 643, 648, 665
MvaI CCWGG 4 cut(s) 337, 360, 590, 856
NciI CCSGG 7 cut(s) 342, 343, 643, 648, 649, 665, 666
NdeII GATC 4 cut(s) 311, 349, 579, 655
NlaIII CATG 5 cut(s) 43, 98, 114, 470, 776
NlaIV GGNNCC 2 cut(s) 629, 669
NmuCI GTSAC 4 cut(s) 457, 605, 763, 871
NsiI ATGCAT 1 cut(s) 112
NspI RCATGY 1 cut(s) 43
NspV TTCGAA 1 cut(s) 242
PaeI GCATGC 1 cut(s) 43
PasI CCCWGGG 2 cut(s) 589, 855
PceI AGGCCT 1 cut(s) 543
PdmI GAANNNNTTC 1 cut(s) 953
PfeI GAWTC 2 cut(s) 915, 981
Pfl23II CGTACG 1 cut(s) 44
PshBI ATTAAT 1 cut(s) 1044
Psp124BI GAGCTC 3 cut(s) 508, 534, 840
Psp6I CCWGG 4 cut(s) 335, 358, 588, 854
PspEI GGTNACC 2 cut(s) 457, 763
PspGI CCWGG 4 cut(s) 335, 358, 588, 854
PspLI CGTACG 1 cut(s) 44
PspN4I GGNNCC 2 cut(s) 629, 669
PspOMI GGGCCC 1 cut(s) 667
PspPI GGNCC 8 cut(s) 91, 339, 362, 628, 645, 667, 668, 942
PsuI RGATCY 1 cut(s) 311
RsaI GTAC 4 cut(s) 5, 21, 46, 80
RsaNI GTAC 4 cut(s) 4, 20, 45, 79
SacI GAGCTC 3 cut(s) 508, 534, 840
SaqAI TTAA 8 cut(s) 248, 495, 801, 891, 924, 999, 1031, 1044
Sau3AI GATC 4 cut(s) 311, 349, 579, 655
Sau96I GGNCC 8 cut(s) 91, 339, 362, 628, 645, 667, 668, 942
SduI GDGCHC 4 cut(s) 508, 534, 671, 840
SfaNI GCATC 1 cut(s) 97
SfcI CTRYAG 2 cut(s) 510, 816
SfuI TTCGAA 1 cut(s) 242
SinI GGWCC 2 cut(s) 628, 942
SmaI CCCGGG 3 cut(s) 343, 649, 666
SphI GCATGC 1 cut(s) 43
Sse9I AATT 6 cut(s) 27, 171, 208, 927, 1034, 1041
SseBI AGGCCT 1 cut(s) 543
SsiI CCGC 3 cut(s) 365, 393, 671
SspI AATATT 1 cut(s) 693
SspMI CTAG 6 cut(s) 188, 479, 525, 551, 785, 900
SstI GAGCTC 3 cut(s) 508, 534, 840
StuI AGGCCT 1 cut(s) 543
TaaI ACNGT 6 cut(s) 8, 300, 377, 419, 683, 725
TaiI ACGT 3 cut(s) 21, 50, 637
TaqI TCGA 1 cut(s) 242
TasI AATT 6 cut(s) 27, 171, 208, 927, 1034, 1041
TatI WGTACW 2 cut(s) 3, 78
TfiI GAWTC 2 cut(s) 915, 981
Tru1I TTAA 8 cut(s) 248, 495, 801, 891, 924, 999, 1031, 1044
Tru9I TTAA 8 cut(s) 248, 495, 801, 891, 924, 999, 1031, 1044
TscAI CASTG 4 cut(s) 71, 458, 764, 838
TseFI GTSAC 4 cut(s) 457, 605, 763, 871
Tsp45I GTSAC 4 cut(s) 457, 605, 763, 871
TspGWI ACGGA 2 cut(s) 362, 668
TspMI CCCGGG 3 cut(s) 341, 647, 664
TspRI CASTG 4 cut(s) 71, 458, 764, 838
VpaK11BI GGWCC 2 cut(s) 628, 942
VspI ATTAAT 1 cut(s) 1044
XapI RAATTY 2 cut(s) 27, 927
XceI RCATGY 1 cut(s) 43
XcmI CCANNNNNNNNNTGG 1 cut(s) 232
XmaI CCCGGG 3 cut(s) 341, 647, 664
XmiI GTMKAC 1 cut(s) 204
XmnI GAANNNNTTC 1 cut(s) 953
XspI CTAG 6 cut(s) 188, 479, 525, 551, 785, 900
ZraI GACGTC 1 cut(s) 635
Zsp2I ATGCAT 1 cut(s) 112
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.