pycom17g21330

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
OG0000158
Physical Location & Seq
Forward (+)
19731136 .. 19732951
1816 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom17g21330.9

Sequence Viewer

Length: 1401 bp
ATGGTAGTTGTCATGCTACTTCTCAGATTCATTCTTATAATATATTGTCTTTGTCCTTTCGTGTTTGTTTCTTTTCTCTTTTGCTCTCTTTCATTGCACCTTCCCACGCGGCTGTATGTCGTTTCTCAAGTCCATATGCAAACATTATTATCTGGAAAAATTTATGTTTCTATATTTTTTATTGCTAAGATAACAGTGATTGCATACAATGAAATCACAATTATAGAGAAATTGAAAGTTGTAGTCAAGAAATTCAACAAGCAATTGAAGTCAATTCCTTTCAATATAATTATGACAGAACAACCAATCGATGTGATAAACTGTGAGGTAAAACACATCTTGCACCAGAATCCGGGCTCGCTCCACCATCGTAACATGATATTGTCCACTTTAGGTCCCGACCACGCCCTCACGGTTTTGTTTCTGGGAACTCACGAGCAACTTCCTAGTGGGTCACCCCATCATGGGATTGCTCTCACACGAACTCGCTTAACTTCGGACGTGCTAGGTAGAGATGAGAATATACATATAAGGCTCACTCCCCTGGGCGATGTGAGATGTCACAATCCACCCCCCTTAAGGGCCCGACATCCTCGTCGGCACACCATGGCCAGGCACTTCCTGGACCCGCTCCACCACCATAGCACAATATTGTCCGGTTTGGGCCCTGACCACGCCCCACGGTTTTGTTTCTGGGAACTCACGATCAACTTTCCAATGGGTCACCCATCATGGGATTGCTCTCGCACGAACTCACTTAACTTCGGAGTTCCTACGGAACCCAAAGCTAGTGAGCTCTCAAAAGACCTCGTGCTAGGTAGAGATGAGAATATACATATAAGGCTCACTCCCCTAGACGATGTGGGATGTCACACCCACACTGTTCCTTTATTTTATCTGACTCACGAACGTCCTCCAATTGGAATCACTCCAAAATGTATCCACTTGATCACGTTTTGCTCAAGAGGAAATCAAATGTACATTGAAAATATAAATCCAATGTATAAAATCGATTCATCAATATGCCTCCATGAAATTCCTAAGAATTATATTAGAGCACCACTTAATCGTTTATACAACAATCTACTAGATTATGGTCCTAAGCTTGAATCTTGTAAATGTATCCTTTCATATTTTGGTCCATTCTCTAATCACTTTTGTTTGTTCTATGGTTGTCGTATTTTGCATAGAACGATATATCCGTTAGTTTCACTGTCTTCCATAATATTTCCATTTTATGCAAAGAATTTGTTGTCCGCTTCCAAGAATATAAAACACCAATGTAGGTTCATTAGGGCAACTCATGGAGTAACTTATGTGATTACATTTAGGGATGTGCTATTCACGCACCCTTTTTACTTCTCACACATCCTCTTAATTTTTGGCAGTTGGATCGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

467

Amino Acids

53.59

Weight (kDa)

9.17

Isoelectric Point (pI)

46.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 38
AasI GACNNNNNNGTC 1 cut(s) 594
AccBSI CCGCTC 1 cut(s) 631
AccII CGCG 1 cut(s) 109
AciI CCGC 3 cut(s) 109, 629, 1257
AclWI GGATC 1 cut(s) 1400
AcoI YGGCCR 1 cut(s) 609
AcsI RAATTY 4 cut(s) 159, 251, 1035, 1246
AfaI GTAC 1 cut(s) 980
AfiI CCNNNNNNNGG 8 cut(s) 352, 464, 465, 579, 580, 612, 733, 920
AflII CTTAAG 1 cut(s) 577
AgsI TTSAA 6 cut(s) 235, 256, 268, 283, 986, 1109
AjiI CACGTC 1 cut(s) 502
AjnI CCWGG 3 cut(s) 543, 611, 621
AloI GAACNNNNNNTCC 2 cut(s) 1183, 1215
AluBI AGCT 3 cut(s) 788, 796, 1105
AluI AGCT 3 cut(s) 788, 796, 1105
Alw21I GWGCWC 2 cut(s) 798, 1060
AlwI GGATC 1 cut(s) 1400
AoxI GGCC 3 cut(s) 582, 609, 664
ApaI GGGCCC 2 cut(s) 586, 668
ApoI RAATTY 4 cut(s) 159, 251, 1035, 1246
AspS9I GGNCC 8 cut(s) 395, 582, 583, 625, 664, 665, 1097, 1139
AsuC2I CCSGG 1 cut(s) 354
AsuHPI GGTGA 2 cut(s) 447, 716
AvaII GGWCC 4 cut(s) 395, 625, 1097, 1139
BaeGI GKGCMC 2 cut(s) 586, 668
BalI TGGCCA 1 cut(s) 611
BanII GRGCYC 4 cut(s) 359, 586, 668, 798
BauI CACGAG 2 cut(s) 434, 809
BbsI GAAGAC 1 cut(s) 1209
Bbv12I GWGCWC 2 cut(s) 798, 1060
BccI CCATC 3 cut(s) 375, 468, 736
BcgI CGANNNNNNTGC 1 cut(s) 1375
BciT130I CCWGG 3 cut(s) 545, 613, 623
BciVI GTATCC 2 cut(s) 950, 1133
BclI TGATCA 1 cut(s) 948
BcnI CCSGG 1 cut(s) 354
BfaI CTAG 6 cut(s) 447, 506, 789, 815, 854, 1088
BfrI CTTAAG 1 cut(s) 577
BfuI GTATCC 2 cut(s) 950, 1133
BisI GCNGC 1 cut(s) 110
BlsI GCNGC 1 cut(s) 111
Bme1390I CCNGG 4 cut(s) 354, 545, 613, 623
Bme18I GGWCC 4 cut(s) 395, 625, 1097, 1139
BmgBI CACGTC 1 cut(s) 502
BmgT120I GGNCC 8 cut(s) 395, 582, 583, 625, 664, 665, 1097, 1139
BmiI GGNNCC 5 cut(s) 397, 584, 627, 666, 780
BmrFI CCNGG 4 cut(s) 354, 545, 613, 623
BpiI GAAGAC 1 cut(s) 1209
Bpu10I CCTNAGC 1 cut(s) 1101
BpuEI CTTGAG 2 cut(s) 111, 946
BpuMI CCSGG 1 cut(s) 354
Bsa29I ATCGAT 2 cut(s) 309, 1011
BsaJI CCNNGG 4 cut(s) 543, 544, 606, 680
BsaWI WCCGGW 1 cut(s) 656
Bsc4I CCNNNNNNNGG 8 cut(s) 352, 464, 465, 579, 580, 612, 733, 920
Bse3DI GCAATG 1 cut(s) 92
BseBI CCWGG 3 cut(s) 545, 613, 623
BseCI ATCGAT 2 cut(s) 309, 1011
BseDI CCNNGG 4 cut(s) 543, 544, 606, 680
BseGI GGATG 4 cut(s) 589, 872, 1339, 1368
BseLI CCNNNNNNNGG 8 cut(s) 352, 464, 465, 579, 580, 612, 733, 920
BseMI GCAATG 1 cut(s) 92
BseMII CTCAG 1 cut(s) 37
BseSI GKGCMC 2 cut(s) 586, 668
Bsh1236I CGCG 1 cut(s) 109
BshFI GGCC 3 cut(s) 584, 611, 666
BshVI ATCGAT 2 cut(s) 309, 1011
BsiHKAI GWGCWC 2 cut(s) 798, 1060
BsiSI CCGG 2 cut(s) 353, 657
BslFI GGGAC 1 cut(s) 381
BslI CCNNNNNNNGG 8 cut(s) 352, 464, 465, 579, 580, 612, 733, 920
BsmFI GGGAC 1 cut(s) 381
BsnI GGCC 3 cut(s) 584, 611, 666
Bsp120I GGGCCC 2 cut(s) 582, 664
Bsp1286I GDGCHC 5 cut(s) 359, 586, 668, 798, 1060
Bsp1407I TGTACA 1 cut(s) 978
Bsp143I GATC 3 cut(s) 705, 948, 1392
Bsp19I CCATGG 1 cut(s) 606
BspACI CCGC 3 cut(s) 109, 629, 1257
BspANI GGCC 3 cut(s) 584, 611, 666
BspCNI CTCAG 1 cut(s) 36
BspDI ATCGAT 2 cut(s) 309, 1011
BspFNI CGCG 1 cut(s) 109
BspLI GGNNCC 5 cut(s) 397, 584, 627, 666, 780
BspPI GGATC 1 cut(s) 1400
BspTI CTTAAG 1 cut(s) 577
BsrBI CCGCTC 1 cut(s) 631
BsrDI GCAATG 1 cut(s) 92
BsrGI TGTACA 1 cut(s) 978
BssECI CCNNGG 4 cut(s) 543, 544, 606, 680
BssMI GATC 3 cut(s) 705, 948, 1392
BssSI CACGAG 2 cut(s) 434, 809
BssT1I CCWWGG 1 cut(s) 606
Bst2BI CACGAG 2 cut(s) 434, 809
Bst2UI CCWGG 3 cut(s) 545, 613, 623
Bst4CI ACNGT 6 cut(s) 196, 323, 415, 684, 883, 1215
BstAFI CTTAAG 1 cut(s) 577
BstAUI TGTACA 1 cut(s) 978
BstC8I GCNNGC 1 cut(s) 359
BstDEI CTNAG 4 cut(s) 23, 186, 1041, 1101
BstDSI CCRYGG 2 cut(s) 606, 680
BstEII GGTNACC 2 cut(s) 453, 722
BstF5I GGATG 4 cut(s) 589, 872, 1339, 1368
BstFNI CGCG 1 cut(s) 109
BstKTI GATC 3 cut(s) 708, 951, 1395
BstMBI GATC 3 cut(s) 705, 948, 1392
BstMWI GCNNNNNNNGC 1 cut(s) 1345
BstNI CCWGG 3 cut(s) 545, 613, 623
BstPI GGTNACC 2 cut(s) 453, 722
BstSCI CCNGG 4 cut(s) 352, 543, 611, 621
BstSLI GKGCMC 2 cut(s) 586, 668
BstUI CGCG 1 cut(s) 109
BstV2I GAAGAC 1 cut(s) 1209
Bsu15I ATCGAT 2 cut(s) 309, 1011
BsuI GTATCC 2 cut(s) 950, 1133
BsuRI GGCC 3 cut(s) 584, 611, 666
BsuTUI ATCGAT 2 cut(s) 309, 1011
BtgI CCRYGG 2 cut(s) 606, 680
BtgZI GCGATG 1 cut(s) 564
BtrI CACGTC 1 cut(s) 502
BtsCI GGATG 4 cut(s) 589, 872, 1339, 1368
BtsIMutI CAGTG 3 cut(s) 201, 879, 1211
Cac8I GCNNGC 1 cut(s) 359
Cfr13I GGNCC 8 cut(s) 395, 582, 583, 625, 664, 665, 1097, 1139
ClaI ATCGAT 2 cut(s) 309, 1011
Csp6I GTAC 1 cut(s) 979
CviAII CATG 7 cut(s) 13, 376, 464, 607, 732, 1031, 1304
CviQI GTAC 1 cut(s) 979
DdeI CTNAG 4 cut(s) 23, 186, 1041, 1101
DpnI GATC 3 cut(s) 707, 950, 1394
DpnII GATC 3 cut(s) 705, 948, 1392
DrdI GACNNNNNNGTC 1 cut(s) 594
DseDI GACNNNNNNGTC 1 cut(s) 594
EaeI YGGCCR 1 cut(s) 609
Ecl136II GAGCTC 1 cut(s) 796
Eco130I CCWWGG 1 cut(s) 606
Eco24I GRGCYC 4 cut(s) 359, 586, 668, 798
Eco47I GGWCC 4 cut(s) 395, 625, 1097, 1139
Eco53kI GAGCTC 1 cut(s) 796
Eco91I GGTNACC 2 cut(s) 453, 722
EcoICRI GAGCTC 1 cut(s) 796
EcoO109I RGGNCCY 3 cut(s) 395, 582, 665
EcoO65I GGTNACC 2 cut(s) 453, 722
EcoRII CCWGG 3 cut(s) 543, 611, 621
EcoT14I CCWWGG 1 cut(s) 606
EcoT38I GRGCYC 4 cut(s) 359, 586, 668, 798
ErhI CCWWGG 1 cut(s) 606
FaeI CATG 7 cut(s) 16, 379, 467, 610, 735, 1034, 1307
FaqI GGGAC 1 cut(s) 381
FatI CATG 7 cut(s) 12, 375, 463, 606, 731, 1030, 1303
FauI CCCGC 1 cut(s) 636
FauNDI CATATG 1 cut(s) 135
FbaI TGATCA 1 cut(s) 948
Fnu4HI GCNGC 1 cut(s) 110
FokI GGATG 4 cut(s) 576, 879, 1346, 1355
FriOI GRGCYC 4 cut(s) 359, 586, 668, 798
Fsp4HI GCNGC 1 cut(s) 110
FspBI CTAG 6 cut(s) 447, 506, 789, 815, 854, 1088
GluI GCNGC 1 cut(s) 110
HaeIII GGCC 3 cut(s) 584, 611, 666
HapII CCGG 2 cut(s) 353, 657
Hin1II CATG 7 cut(s) 16, 379, 467, 610, 735, 1034, 1307
HindIII AAGCTT 1 cut(s) 1103
HinfI GANTC 6 cut(s) 27, 349, 901, 924, 1013, 1109
HpaII CCGG 2 cut(s) 353, 657
HphI GGTGA 2 cut(s) 447, 716
Hpy166II GTNNAC 1 cut(s) 387
Hpy188I TCNGA 4 cut(s) 26, 499, 767, 900
Hpy188III TCNNGA 7 cut(s) 153, 247, 398, 434, 703, 905, 963
Hpy8I GTNNAC 1 cut(s) 387
Hpy99I CGWCG 1 cut(s) 600
HpyAV CCTTC 1 cut(s) 110
HpyCH4III ACNGT 6 cut(s) 196, 323, 415, 684, 883, 1215
HpyCH4IV ACGT 3 cut(s) 501, 910, 953
HpyCH4V TGCA 6 cut(s) 97, 139, 203, 343, 1186, 1241
HpyF10VI GCNNNNNNNGC 1 cut(s) 1345
HpyF3I CTNAG 4 cut(s) 23, 186, 1041, 1101
HpySE526I ACGT 3 cut(s) 501, 910, 953
Hsp92II CATG 7 cut(s) 16, 379, 467, 610, 735, 1034, 1307
Ksp22I TGATCA 1 cut(s) 948
Kzo9I GATC 3 cut(s) 705, 948, 1392
LmnI GCTCC 2 cut(s) 366, 636
MaeI CTAG 6 cut(s) 447, 506, 789, 815, 854, 1088
MaeII ACGT 3 cut(s) 501, 910, 953
MaeIII GTNAC 6 cut(s) 371, 453, 560, 722, 869, 1309
MalI GATC 3 cut(s) 707, 950, 1394
MbiI CCGCTC 1 cut(s) 631
MboI GATC 3 cut(s) 705, 948, 1392
MboII GAAGA 1 cut(s) 1209
MfeI CAATTG 2 cut(s) 263, 918
MhlI GDGCHC 5 cut(s) 359, 586, 668, 798, 1060
MlsI TGGCCA 1 cut(s) 611
MluNI TGGCCA 1 cut(s) 611
MlyI GAGTC 1 cut(s) 895
MmeI TCCRAC 1 cut(s) 1370
MnlI CCTC 8 cut(s) 319, 419, 603, 818, 924, 959, 1037, 1382
Mox20I TGGCCA 1 cut(s) 611
MscI TGGCCA 1 cut(s) 611
MseI TTAA 5 cut(s) 491, 578, 759, 1065, 1376
MslI CAYNNNNRTG 1 cut(s) 1021
Msp20I TGGCCA 1 cut(s) 611
MspCI CTTAAG 1 cut(s) 577
MspI CCGG 2 cut(s) 353, 657
MspR9I CCNGG 4 cut(s) 354, 545, 613, 623
MunI CAATTG 2 cut(s) 263, 918
MvaI CCWGG 3 cut(s) 545, 613, 623
MvnI CGCG 1 cut(s) 109
MwoI GCNNNNNNNGC 1 cut(s) 1345
NciI CCSGG 1 cut(s) 354
NcoI CCATGG 1 cut(s) 606
NdeI CATATG 1 cut(s) 135
NdeII GATC 3 cut(s) 705, 948, 1392
NlaIII CATG 7 cut(s) 16, 379, 467, 610, 735, 1034, 1307
NlaIV GGNNCC 5 cut(s) 397, 584, 627, 666, 780
NmuCI GTSAC 4 cut(s) 453, 560, 722, 869
PasI CCCWGGG 1 cut(s) 544
PcsI WCGNNNNNNNCGW 1 cut(s) 1199
PfeI GAWTC 5 cut(s) 27, 349, 924, 1013, 1109
PfoI TCCNGGA 1 cut(s) 621
PkrI GCNGC 1 cut(s) 111
PleI GAGTC 1 cut(s) 895
PpsI GAGTC 1 cut(s) 895
PpuMI RGGWCCY 1 cut(s) 395
PsiI TTATAA 1 cut(s) 38
Psp124BI GAGCTC 1 cut(s) 798
Psp5II RGGWCCY 1 cut(s) 395
Psp6I CCWGG 3 cut(s) 543, 611, 621
PspEI GGTNACC 2 cut(s) 453, 722
PspGI CCWGG 3 cut(s) 543, 611, 621
PspN4I GGNNCC 5 cut(s) 397, 584, 627, 666, 780
PspOMI GGGCCC 2 cut(s) 582, 664
PspPI GGNCC 8 cut(s) 395, 582, 583, 625, 664, 665, 1097, 1139
PspPPI RGGWCCY 1 cut(s) 395
RsaI GTAC 1 cut(s) 980
RsaNI GTAC 1 cut(s) 979
RseI CAYNNNNRTG 1 cut(s) 1021
SacI GAGCTC 1 cut(s) 798
SaqAI TTAA 5 cut(s) 491, 578, 759, 1065, 1376
SatI GCNGC 1 cut(s) 110
Sau3AI GATC 3 cut(s) 705, 948, 1392
Sau96I GGNCC 8 cut(s) 395, 582, 583, 625, 664, 665, 1097, 1139
SchI GAGTC 1 cut(s) 895
ScrFI CCNGG 4 cut(s) 354, 545, 613, 623
SduI GDGCHC 5 cut(s) 359, 586, 668, 798, 1060
SinI GGWCC 4 cut(s) 395, 625, 1097, 1139
SmiMI CAYNNNNRTG 1 cut(s) 1021
SmlI CTYRAG 3 cut(s) 126, 577, 961
SmoI CTYRAG 3 cut(s) 126, 577, 961
SsiI CCGC 3 cut(s) 109, 629, 1257
SspI AATATT 2 cut(s) 651, 1227
SspMI CTAG 6 cut(s) 447, 506, 789, 815, 854, 1088
SstI GAGCTC 1 cut(s) 798
StyD4I CCNGG 4 cut(s) 352, 543, 611, 621
StyI CCWWGG 1 cut(s) 606
TaaI ACNGT 6 cut(s) 196, 323, 415, 684, 883, 1215
TaiI ACGT 3 cut(s) 504, 913, 956
TaqI TCGA 3 cut(s) 309, 1011, 1395
TatI WGTACW 1 cut(s) 978
TauI GCSGC 1 cut(s) 112
TfiI GAWTC 5 cut(s) 27, 349, 924, 1013, 1109
Tru1I TTAA 5 cut(s) 491, 578, 759, 1065, 1376
Tru9I TTAA 5 cut(s) 491, 578, 759, 1065, 1376
TscAI CASTG 3 cut(s) 201, 886, 1218
TseFI GTSAC 4 cut(s) 453, 560, 722, 869
Tsp45I GTSAC 4 cut(s) 453, 560, 722, 869
TspDTI ATGAA 7 cut(s) 19, 81, 225, 1005, 1047, 1119, 1279
TspGWI ACGGA 2 cut(s) 791, 1191
TspRI CASTG 3 cut(s) 201, 886, 1218
Vha464I CTTAAG 1 cut(s) 577
VpaK11BI GGWCC 4 cut(s) 395, 625, 1097, 1139
XapI RAATTY 4 cut(s) 159, 251, 1035, 1246
XcmI CCANNNNNNNNNTGG 1 cut(s) 619
XspI CTAG 6 cut(s) 447, 506, 789, 815, 854, 1088
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.