pycom17g17170

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
OG0000158
Physical Location & Seq
Forward (+)
15005189 .. 15006618
1430 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom17g17170.4

Sequence Viewer

Length: 1185 bp
ATGGATTTTCAAGTTCTAGAAGCATATGAAAATTTAAATCTAAAACAAGCATGCTGCTTCACTTTGGAAATAAAGCTGATTAGCAGATTGGAAAGAATCGTAATATACCTGGCCAATATACATATCACACATATTTATCACATTCTTGCAGCCCACACATGGAGCTTTCCTTGGGAAACATTGGGTCATTATGCCATAATCAAACAATTTCACGGGTCATTGTGTCCATTCATACATTTCTCAACATTCTTAATTGCACATGTATTATACTACTTTTCATCTACTTTCACAATTAAACATTCATCTCAACATGTTAAAAACGCGATCTTGAAAAACCTTTGCAATTACTTTAAACTCACCAAAGTTGTAGAAAGAAAATTAAAATCATTAGAATCAAACTATAGAGAAACATTTTCTTCACTTCTTTCATATAATCGTAAATCCTGGCCCGGGGCGGACCACTTCCCGGGCCCACTCCACCACCGTAGCACGATATTGTCCGCTTTGGGTTTACCATTCCTTCACGGTTTTGTTTTTGGGAACTCACGAGCAACTTCCCAGTGGGTCACCCTTCATGGGATTGCTCTAGCCCCCTTCTCGCTTAACTTCGAAGTTCCTACGGAACCCGAAGCCAGTGAGCTCCCAAAAGGCCTCATGCTAGGTAAGGATGGGAATATACATATAAGGATCACTCCCCTGGGCGATGTGGGATGTCACAATCCACCCCCCTTAGGGGCCCGACACCAATTTGTCACATCCCCGCCCGGGACGGACCACTTCCCGGGCCCGCTCCACCACCGTAGCACGATATTGTCCGCTTTGGGCTTACCATTCCCTCACGGTTTTGTTTTTGGGAACTCACGAGCAACTTCCCAGTGGGTCACCCATCATGGGATTGTTCTAGCCCCTTTCTCGCTTAACTTCGGAGTTCCTACGAAACCCGAAGCCAGTGAGCTCCCAAAAGGCCTCATGCTAGGTAAGGATGAGAATATACATATAAGGATCACTCCCTTGGGCGATGTGCGATGTCACATAAAATACAATTTTGTTGATGTTCAACTCCCACGGTGTTCGTCAATTTGTTTCGCAATCACCTTGTCCTTCTCTTCCTTATCTATAAGTAGGAAAAATCGTCAAACATTGCTTGTACAAATAACAGACAAGCAGACCCTAAGTCAGAGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

395

Amino Acids

44.3

Weight (kDa)

9.29

Isoelectric Point (pI)

43.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 790
AccII CGCG 1 cut(s) 323
AciI CCGC 5 cut(s) 455, 501, 761, 788, 816
AclWI GGATC 2 cut(s) 695, 1010
AcoI YGGCCR 1 cut(s) 111
AcsI RAATTY 1 cut(s) 31
AfaI GTAC 1 cut(s) 1149
AflIII ACRYGT 2 cut(s) 259, 310
AgsI TTSAA 3 cut(s) 11, 331, 1058
AhdI GACNNNNNGTC 1 cut(s) 1173
AjnI CCWGG 3 cut(s) 108, 443, 696
AluBI AGCT 4 cut(s) 76, 165, 640, 955
AluI AGCT 4 cut(s) 76, 165, 640, 955
Alw21I GWGCWC 2 cut(s) 642, 957
AlwI GGATC 2 cut(s) 695, 1010
Ama87I CYCGRG 4 cut(s) 449, 466, 764, 781
AoxI GGCC 7 cut(s) 111, 446, 469, 649, 735, 784, 964
ApaI GGGCCC 3 cut(s) 473, 739, 788
ApeKI GCWGC 2 cut(s) 54, 149
ApoI RAATTY 1 cut(s) 31
AspS9I GGNCC 9 cut(s) 447, 457, 469, 470, 735, 736, 772, 784, 785
AsuC2I CCSGG 8 cut(s) 450, 451, 467, 468, 765, 766, 782, 783
AsuHPI GGTGA 4 cut(s) 349, 559, 874, 1084
AsuII TTCGAA 1 cut(s) 609
AvaI CYCGRG 4 cut(s) 449, 466, 764, 781
AvaII GGWCC 2 cut(s) 457, 772
AxyI CCTNAGG 1 cut(s) 730
BaeGI GKGCMC 3 cut(s) 473, 739, 788
BalI TGGCCA 1 cut(s) 113
BanII GRGCYC 5 cut(s) 473, 642, 739, 788, 957
BauI CACGAG 2 cut(s) 546, 861
Bbv12I GWGCWC 2 cut(s) 642, 957
BbvI GCAGC 2 cut(s) 41, 161
BccI CCATC 2 cut(s) 662, 894
BciT130I CCWGG 3 cut(s) 110, 445, 698
BcnI CCSGG 8 cut(s) 450, 451, 467, 468, 765, 766, 782, 783
BfaI CTAG 5 cut(s) 17, 587, 659, 902, 974
BfmI CTRYAG 1 cut(s) 400
BisI GCNGC 2 cut(s) 55, 150
BlsI GCNGC 2 cut(s) 56, 151
Bme18I GGWCC 2 cut(s) 457, 772
BmeRI GACNNNNNGTC 1 cut(s) 1173
BmeT110I CYCGRG 4 cut(s) 449, 466, 764, 781
BmgT120I GGNCC 9 cut(s) 447, 457, 469, 470, 735, 736, 772, 784, 785
BmiI GGNNCC 5 cut(s) 471, 624, 736, 737, 786
BmrI ACTGGG 2 cut(s) 553, 868
BmuI ACTGGG 2 cut(s) 553, 868
Bpu14I TTCGAA 1 cut(s) 609
BpuMI CCSGG 8 cut(s) 450, 451, 467, 468, 765, 766, 782, 783
Bse1I ACTGG 4 cut(s) 559, 633, 874, 948
Bse21I CCTNAGG 1 cut(s) 730
Bse3DI GCAATG 1 cut(s) 1139
BseBI CCWGG 3 cut(s) 110, 445, 698
BseGI GGATG 4 cut(s) 673, 716, 755, 988
BseMI GCAATG 1 cut(s) 1139
BseNI ACTGG 4 cut(s) 559, 633, 874, 948
BseSI GKGCMC 3 cut(s) 473, 739, 788
BseXI GCAGC 2 cut(s) 41, 161
Bsh1236I CGCG 1 cut(s) 323
BshFI GGCC 7 cut(s) 113, 448, 471, 651, 737, 786, 966
BsiHKAI GWGCWC 2 cut(s) 642, 957
BsiHKCI CYCGRG 4 cut(s) 449, 466, 764, 781
BsiSI CCGG 4 cut(s) 450, 467, 765, 782
BslFI GGGAC 1 cut(s) 781
BsmFI GGGAC 1 cut(s) 781
BsnI GGCC 7 cut(s) 113, 448, 471, 651, 737, 786, 966
BsoBI CYCGRG 4 cut(s) 449, 466, 764, 781
Bsp119I TTCGAA 1 cut(s) 609
Bsp120I GGGCCC 3 cut(s) 469, 735, 784
Bsp1286I GDGCHC 5 cut(s) 473, 642, 739, 788, 957
Bsp1407I TGTACA 1 cut(s) 1147
Bsp143I GATC 3 cut(s) 324, 687, 1002
BspACI CCGC 5 cut(s) 455, 501, 761, 788, 816
BspANI GGCC 7 cut(s) 113, 448, 471, 651, 737, 786, 966
BspFNI CGCG 1 cut(s) 323
BspLI GGNNCC 5 cut(s) 471, 624, 736, 737, 786
BspPI GGATC 2 cut(s) 695, 1010
BspT104I TTCGAA 1 cut(s) 609
BsrBI CCGCTC 1 cut(s) 790
BsrDI GCAATG 1 cut(s) 1139
BsrGI TGTACA 1 cut(s) 1147
BsrI ACTGG 4 cut(s) 559, 633, 874, 948
BssMI GATC 3 cut(s) 324, 687, 1002
BssSI CACGAG 2 cut(s) 546, 861
BssT1I CCWWGG 2 cut(s) 170, 1011
Bst2BI CACGAG 2 cut(s) 546, 861
Bst2UI CCWGG 3 cut(s) 110, 445, 698
Bst4CI ACNGT 5 cut(s) 485, 527, 800, 842, 1068
Bst6I CTCTTC 1 cut(s) 1111
BstAUI TGTACA 1 cut(s) 1147
BstBI TTCGAA 1 cut(s) 609
BstC8I GCNNGC 2 cut(s) 52, 788
BstDEI CTNAG 2 cut(s) 730, 1172
BstDSI CCRYGG 1 cut(s) 1064
BstEII GGTNACC 2 cut(s) 565, 880
BstF5I GGATG 4 cut(s) 673, 716, 755, 988
BstFNI CGCG 1 cut(s) 323
BstKTI GATC 3 cut(s) 327, 690, 1005
BstMBI GATC 3 cut(s) 324, 687, 1002
BstNI CCWGG 3 cut(s) 110, 445, 698
BstNSI RCATGY 3 cut(s) 54, 263, 314
BstPI GGTNACC 2 cut(s) 565, 880
BstSFI CTRYAG 1 cut(s) 400
BstSLI GKGCMC 3 cut(s) 473, 739, 788
BstUI CGCG 1 cut(s) 323
BstV1I GCAGC 2 cut(s) 41, 161
Bsu36I CCTNAGG 1 cut(s) 730
BsuRI GGCC 7 cut(s) 113, 448, 471, 651, 737, 786, 966
BtgI CCRYGG 1 cut(s) 1064
BtgZI GCGATG 3 cut(s) 717, 1032, 1039
BtsCI GGATG 4 cut(s) 673, 716, 755, 988
BtsIMutI CAGTG 4 cut(s) 566, 640, 881, 955
Cac8I GCNNGC 2 cut(s) 52, 788
Cfr13I GGNCC 9 cut(s) 447, 457, 469, 470, 735, 736, 772, 784, 785
Cfr9I CCCGGG 4 cut(s) 449, 466, 764, 781
Csp6I GTAC 1 cut(s) 1148
CviAII CATG 8 cut(s) 51, 159, 260, 311, 575, 655, 890, 970
CviQI GTAC 1 cut(s) 1148
DdeI CTNAG 2 cut(s) 730, 1172
DpnI GATC 3 cut(s) 326, 689, 1004
DpnII GATC 3 cut(s) 324, 687, 1002
DraI TTTAAA 2 cut(s) 36, 352
DriI GACNNNNNGTC 1 cut(s) 1173
EaeI YGGCCR 1 cut(s) 111
Eam1104I CTCTTC 1 cut(s) 1111
Eam1105I GACNNNNNGTC 1 cut(s) 1173
EarI CTCTTC 1 cut(s) 1111
EciI GGCGGA 1 cut(s) 470
Ecl136II GAGCTC 2 cut(s) 640, 955
Eco130I CCWWGG 2 cut(s) 170, 1011
Eco147I AGGCCT 2 cut(s) 651, 966
Eco24I GRGCYC 5 cut(s) 473, 642, 739, 788, 957
Eco47I GGWCC 2 cut(s) 457, 772
Eco53kI GAGCTC 2 cut(s) 640, 955
Eco81I CCTNAGG 1 cut(s) 730
Eco88I CYCGRG 4 cut(s) 449, 466, 764, 781
Eco91I GGTNACC 2 cut(s) 565, 880
EcoICRI GAGCTC 2 cut(s) 640, 955
EcoO109I RGGNCCY 1 cut(s) 735
EcoO65I GGTNACC 2 cut(s) 565, 880
EcoRII CCWGG 3 cut(s) 108, 443, 696
EcoT14I CCWWGG 2 cut(s) 170, 1011
EcoT38I GRGCYC 5 cut(s) 473, 642, 739, 788, 957
ErhI CCWWGG 2 cut(s) 170, 1011
FaeI CATG 8 cut(s) 54, 162, 263, 314, 578, 658, 893, 973
FaqI GGGAC 1 cut(s) 781
FatI CATG 8 cut(s) 50, 158, 259, 310, 574, 654, 889, 969
FauI CCCGC 2 cut(s) 768, 795
FauNDI CATATG 1 cut(s) 25
Fnu4HI GCNGC 2 cut(s) 55, 150
FokI GGATG 4 cut(s) 680, 723, 742, 995
FriOI GRGCYC 5 cut(s) 473, 642, 739, 788, 957
Fsp4HI GCNGC 2 cut(s) 55, 150
FspBI CTAG 5 cut(s) 17, 587, 659, 902, 974
GluI GCNGC 2 cut(s) 55, 150
HaeIII GGCC 7 cut(s) 113, 448, 471, 651, 737, 786, 966
HapII CCGG 4 cut(s) 450, 467, 765, 782
Hin1II CATG 8 cut(s) 54, 162, 263, 314, 578, 658, 893, 973
HinfI GANTC 2 cut(s) 96, 392
HpaII CCGG 4 cut(s) 450, 467, 765, 782
HphI GGTGA 4 cut(s) 349, 559, 874, 1084
Hpy166II GTNNAC 1 cut(s) 512
Hpy188I TCNGA 2 cut(s) 926, 1179
Hpy188III TCNNGA 4 cut(s) 17, 328, 546, 861
Hpy8I GTNNAC 1 cut(s) 512
HpyAV CCTTC 4 cut(s) 530, 581, 604, 1111
HpyCH4III ACNGT 5 cut(s) 485, 527, 800, 842, 1068
HpyCH4V TGCA 3 cut(s) 149, 257, 342
HpyF3I CTNAG 2 cut(s) 730, 1172
Hsp92II CATG 8 cut(s) 54, 162, 263, 314, 578, 658, 893, 973
Kzo9I GATC 3 cut(s) 324, 687, 1002
LmnI GCTCC 4 cut(s) 162, 645, 795, 960
Lsp1109I GCAGC 2 cut(s) 41, 161
MaeI CTAG 5 cut(s) 17, 587, 659, 902, 974
MaeIII GTNAC 5 cut(s) 565, 713, 751, 880, 1028
MalI GATC 3 cut(s) 326, 689, 1004
MbiI CCGCTC 1 cut(s) 790
MboI GATC 3 cut(s) 324, 687, 1002
MboII GAAGA 2 cut(s) 408, 1098
MhlI GDGCHC 5 cut(s) 473, 642, 739, 788, 957
MlsI TGGCCA 1 cut(s) 113
MluCI AATT 9 cut(s) 31, 206, 252, 291, 343, 377, 746, 1042, 1077
MluNI TGGCCA 1 cut(s) 113
MnlI CCTC 3 cut(s) 662, 846, 977
Mox20I TGGCCA 1 cut(s) 113
MscI TGGCCA 1 cut(s) 113
MseI TTAA 9 cut(s) 35, 251, 294, 315, 351, 380, 603, 918, 1183
Msp20I TGGCCA 1 cut(s) 113
MspI CCGG 4 cut(s) 450, 467, 765, 782
MvaI CCWGG 3 cut(s) 110, 445, 698
MvnI CGCG 1 cut(s) 323
NciI CCSGG 8 cut(s) 450, 451, 467, 468, 765, 766, 782, 783
NdeI CATATG 1 cut(s) 25
NdeII GATC 3 cut(s) 324, 687, 1002
NlaIII CATG 8 cut(s) 54, 162, 263, 314, 578, 658, 893, 973
NlaIV GGNNCC 5 cut(s) 471, 624, 736, 737, 786
NmuCI GTSAC 5 cut(s) 565, 713, 751, 880, 1028
NspI RCATGY 3 cut(s) 54, 263, 314
NspV TTCGAA 1 cut(s) 609
PaeI GCATGC 1 cut(s) 54
PasI CCCWGGG 1 cut(s) 697
PceI AGGCCT 2 cut(s) 651, 966
PciI ACATGT 2 cut(s) 259, 310
PfeI GAWTC 2 cut(s) 96, 392
PkrI GCNGC 2 cut(s) 56, 151
PscI ACATGT 2 cut(s) 259, 310
Psp124BI GAGCTC 2 cut(s) 642, 957
Psp6I CCWGG 3 cut(s) 108, 443, 696
PspEI GGTNACC 2 cut(s) 565, 880
PspGI CCWGG 3 cut(s) 108, 443, 696
PspN4I GGNNCC 5 cut(s) 471, 624, 736, 737, 786
PspOMI GGGCCC 3 cut(s) 469, 735, 784
PspPI GGNCC 9 cut(s) 447, 457, 469, 470, 735, 736, 772, 784, 785
RsaI GTAC 1 cut(s) 1149
RsaNI GTAC 1 cut(s) 1148
SacI GAGCTC 2 cut(s) 642, 957
SaqAI TTAA 9 cut(s) 35, 251, 294, 315, 351, 380, 603, 918, 1183
SatI GCNGC 2 cut(s) 55, 150
Sau3AI GATC 3 cut(s) 324, 687, 1002
Sau96I GGNCC 9 cut(s) 447, 457, 469, 470, 735, 736, 772, 784, 785
SduI GDGCHC 5 cut(s) 473, 642, 739, 788, 957
SetI ASST 9 cut(s) 78, 111, 167, 339, 642, 664, 957, 979, 1097
SfcI CTRYAG 1 cut(s) 400
SfuI TTCGAA 1 cut(s) 609
SinI GGWCC 2 cut(s) 457, 772
SmaI CCCGGG 4 cut(s) 451, 468, 766, 783
SmiI ATTTAAAT 1 cut(s) 36
SphI GCATGC 1 cut(s) 54
Sse9I AATT 9 cut(s) 31, 206, 252, 291, 343, 377, 746, 1042, 1077
SseBI AGGCCT 2 cut(s) 651, 966
SsiI CCGC 5 cut(s) 455, 501, 761, 788, 816
SspMI CTAG 5 cut(s) 17, 587, 659, 902, 974
SstI GAGCTC 2 cut(s) 642, 957
StuI AGGCCT 2 cut(s) 651, 966
StyI CCWWGG 2 cut(s) 170, 1011
SwaI ATTTAAAT 1 cut(s) 36
TaaI ACNGT 5 cut(s) 485, 527, 800, 842, 1068
TaqI TCGA 1 cut(s) 609
TasI AATT 9 cut(s) 31, 206, 252, 291, 343, 377, 746, 1042, 1077
TatI WGTACW 1 cut(s) 1147
TfiI GAWTC 2 cut(s) 96, 392
Tru1I TTAA 9 cut(s) 35, 251, 294, 315, 351, 380, 603, 918, 1183
Tru9I TTAA 9 cut(s) 35, 251, 294, 315, 351, 380, 603, 918, 1183
TscAI CASTG 4 cut(s) 566, 640, 881, 955
TseFI GTSAC 5 cut(s) 565, 713, 751, 880, 1028
TseI GCWGC 2 cut(s) 54, 149
Tsp45I GTSAC 5 cut(s) 565, 713, 751, 880, 1028
TspDTI ATGAA 6 cut(s) 42, 220, 267, 291, 417, 563
TspGWI ACGGA 2 cut(s) 635, 785
TspMI CCCGGG 4 cut(s) 449, 466, 764, 781
TspRI CASTG 4 cut(s) 566, 640, 881, 955
VpaK11BI GGWCC 2 cut(s) 457, 772
XapI RAATTY 1 cut(s) 31
XbaI TCTAGA 1 cut(s) 16
XceI RCATGY 3 cut(s) 54, 263, 314
XmaI CCCGGG 4 cut(s) 449, 466, 764, 781
XspI CTAG 5 cut(s) 17, 587, 659, 902, 974
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.