pycom1256g00130

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00001256
OG0000158
Physical Location & Seq
Forward (+)
77833 .. 79023
1191 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom1256g00130.7

Sequence Viewer

Length: 891 bp
ATGTGGTATTCTTTAAATGTGTCATGTTCATTGGAAATCCCTGAGGTACATGTTGGAAGGTCTAGATTGTGTTTTGTTCATTTCGTTTTGCTCGAGGGTTGTTTCCTTGCATTTATGAAGTTAATTACTATTTATTTCAGTCTTTTAAGTTATTTTCGTATGTTTTTAGGTCCTAATGGCAAAAGGAGCAAGAAAGTGCATTTTGAGGCTATTTGGAGATGGACGAAATTGAAGTCAAGAAGAGCTAGGAAAGGCTACAAATCTGGTGGAAGAAGTCCTAATGCAATGAAGATAAGGAAGAAGCAAGAAACAAGGAACCTTATCCAACCTTATCCAACCTTATCTTATCCTATCCTAGAAACCTTATCCTATCCTAACTCCAACATTATCCTATTCTATCCTATCCAAATCAGGTTAGGACTTAAACCTAGCCGCAAGAACACCATTCCTTGTAGGTTTAGGAATTGTAATCCTTCTCCTACACAAATATCATGTATCCTTGGCCCTTTAGGTTTAGGAATCTGCCCTAAACCATCCCTTCTAGAAACCTTATCTCAGCCCTCTAAACATGCCGCACCAAAACCTTCTAGAATCCCTAAATCCTATAACCCTTTTTTCAATGGGATTGTGCAACCCTTTTCCTTCACTAAGTTCATTCATCCATTCAGACATTCATTCATTCATACCTTCATCCATCAAACACTACAATCCATTCTACACCACCCTAGTGCCGCAAGCAAGGAAGCAAGGAGAGGAGGACTTGTGCAATCTGCCATCCAAGGAGGGTTCGAAATCTGCCATTGGAGTGTGGAACGTTTTTCTTGGTGCTTTCTATCCTTAGTCTTAGTTCAATGTTTAAATTTAATTATCTTTGAGAATTTGAAGCCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

297

Amino Acids

34.05

Weight (kDa)

10.23

Isoelectric Point (pI)

49.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 433, 573, 732
AclI AACGTT 1 cut(s) 814
AcsI RAATTY 2 cut(s) 859, 877
AfaI GTAC 1 cut(s) 48
AflIII ACRYGT 1 cut(s) 49
AgsI TTSAA 4 cut(s) 232, 619, 851, 883
AleI CACNNNNGTG 1 cut(s) 726
AluBI AGCT 1 cut(s) 245
AluI AGCT 1 cut(s) 245
Ama87I CYCGRG 1 cut(s) 92
AoxI GGCC 1 cut(s) 502
ApoI RAATTY 2 cut(s) 859, 877
ArsI GACNNNNNNTTYG 2 cut(s) 218, 250
AspS9I GGNCC 2 cut(s) 170, 503
AsuII TTCGAA 1 cut(s) 789
AvaI CYCGRG 1 cut(s) 92
AvaII GGWCC 1 cut(s) 170
AxyI CCTNAGG 1 cut(s) 42
BccI CCATC 4 cut(s) 213, 541, 702, 782
BciVI GTATCC 1 cut(s) 506
BfaI CTAG 7 cut(s) 63, 246, 356, 429, 542, 588, 726
BfuI GTATCC 1 cut(s) 506
BisI GCNGC 3 cut(s) 433, 573, 732
BlsI GCNGC 3 cut(s) 434, 574, 733
Bme18I GGWCC 1 cut(s) 170
BmeT110I CYCGRG 1 cut(s) 92
BmgT120I GGNCC 2 cut(s) 170, 503
BmiI GGNNCC 1 cut(s) 317
Bpu14I TTCGAA 1 cut(s) 789
BsaJI CCNNGG 2 cut(s) 499, 778
BsaXI ACNNNNNCTCC 2 cut(s) 747, 777
Bse21I CCTNAGG 1 cut(s) 42
Bse3DI GCAATG 1 cut(s) 291
BseDI CCNNGG 2 cut(s) 499, 778
BseGI GGATG 4 cut(s) 533, 658, 690, 774
BseMI GCAATG 1 cut(s) 291
BseMII CTCAG 2 cut(s) 33, 569
BseRI GAGGAG 1 cut(s) 768
BshFI GGCC 1 cut(s) 504
BsiHKCI CYCGRG 1 cut(s) 92
BsnI GGCC 1 cut(s) 504
BsoBI CYCGRG 1 cut(s) 92
Bsp119I TTCGAA 1 cut(s) 789
BspACI CCGC 3 cut(s) 433, 573, 732
BspANI GGCC 1 cut(s) 504
BspCNI CTCAG 2 cut(s) 34, 568
BspLI GGNNCC 1 cut(s) 317
BspQI GCTCTTC 1 cut(s) 235
BspT104I TTCGAA 1 cut(s) 789
BsrDI GCAATG 1 cut(s) 291
BssECI CCNNGG 2 cut(s) 499, 778
BssT1I CCWWGG 2 cut(s) 499, 778
Bst6I CTCTTC 1 cut(s) 235
BstBI TTCGAA 1 cut(s) 789
BstC8I GCNNGC 1 cut(s) 736
BstDEI CTNAG 5 cut(s) 42, 555, 648, 838, 844
BstF5I GGATG 4 cut(s) 533, 658, 690, 774
BstMWI GCNNNNNNNGC 1 cut(s) 186
BstNSI RCATGY 2 cut(s) 53, 572
Bsu36I CCTNAGG 1 cut(s) 42
BsuI GTATCC 1 cut(s) 506
BsuRI GGCC 1 cut(s) 504
BtsCI GGATG 4 cut(s) 533, 658, 690, 774
Cac8I GCNNGC 1 cut(s) 736
Cfr13I GGNCC 2 cut(s) 170, 503
Csp6I GTAC 1 cut(s) 47
CspCI CAANNNNNGTGG 2 cut(s) 247, 282
CviAII CATG 5 cut(s) 24, 50, 492, 569, 888
CviJI RGCY 7 cut(s) 209, 245, 255, 432, 504, 559, 886
CviKI_1 RGCY 7 cut(s) 209, 245, 255, 432, 504, 559, 886
CviQI GTAC 1 cut(s) 47
DdeI CTNAG 5 cut(s) 42, 555, 648, 838, 844
DraI TTTAAA 2 cut(s) 15, 858
Eam1104I CTCTTC 1 cut(s) 235
EarI CTCTTC 1 cut(s) 235
Eco130I CCWWGG 2 cut(s) 499, 778
Eco47I GGWCC 1 cut(s) 170
Eco81I CCTNAGG 1 cut(s) 42
Eco88I CYCGRG 1 cut(s) 92
EcoO109I RGGNCCY 1 cut(s) 170
EcoT14I CCWWGG 2 cut(s) 499, 778
ErhI CCWWGG 2 cut(s) 499, 778
FaeI CATG 5 cut(s) 27, 53, 495, 572, 891
FaiI YATR 9 cut(s) 25, 51, 116, 161, 493, 570, 606, 684, 889
FatI CATG 5 cut(s) 23, 49, 491, 568, 887
Fnu4HI GCNGC 3 cut(s) 433, 573, 732
FokI GGATG 4 cut(s) 520, 645, 677, 761
Fsp4HI GCNGC 3 cut(s) 433, 573, 732
FspBI CTAG 7 cut(s) 63, 246, 356, 429, 542, 588, 726
GluI GCNGC 3 cut(s) 433, 573, 732
HaeIII GGCC 1 cut(s) 504
Hin1II CATG 5 cut(s) 27, 53, 495, 572, 891
HinfI GANTC 2 cut(s) 519, 591
Hpy188I TCNGA 1 cut(s) 668
Hpy188III TCNNGA 4 cut(s) 63, 237, 542, 588
HpyAV CCTTC 6 cut(s) 51, 483, 548, 594, 652, 697
HpyCH4IV ACGT 1 cut(s) 814
HpyCH4V TGCA 5 cut(s) 110, 199, 284, 631, 766
HpyF10VI GCNNNNNNNGC 1 cut(s) 186
HpyF3I CTNAG 5 cut(s) 42, 555, 648, 838, 844
HpySE526I ACGT 1 cut(s) 814
Hsp92II CATG 5 cut(s) 27, 53, 495, 572, 891
LguI GCTCTTC 1 cut(s) 235
LmnI GCTCC 1 cut(s) 186
LpnPI CCDG 3 cut(s) 54, 249, 397
MaeI CTAG 7 cut(s) 63, 246, 356, 429, 542, 588, 726
MaeII ACGT 1 cut(s) 814
MboII GAAGA 4 cut(s) 252, 282, 301, 310
MluCI AATT 6 cut(s) 123, 227, 463, 859, 864, 877
MmeI TCCRAC 4 cut(s) 34, 349, 359, 405
MnlI CCTC 7 cut(s) 37, 88, 199, 571, 746, 749, 776
MseI TTAA 6 cut(s) 14, 122, 146, 423, 857, 863
MslI CAYNNNNRTG 2 cut(s) 726, 804
MwoI GCNNNNNNNGC 1 cut(s) 186
NlaIII CATG 5 cut(s) 27, 53, 495, 572, 891
NlaIV GGNNCC 1 cut(s) 317
NspI RCATGY 2 cut(s) 53, 572
NspV TTCGAA 1 cut(s) 789
OliI CACNNNNGTG 1 cut(s) 726
PaeR7I CTCGAG 1 cut(s) 92
PciI ACATGT 1 cut(s) 49
PciSI GCTCTTC 1 cut(s) 235
PcsI WCGNNNNNNNCGW 1 cut(s) 90
PfeI GAWTC 2 cut(s) 519, 591
PkrI GCNGC 3 cut(s) 434, 574, 733
PpuMI RGGWCCY 1 cut(s) 170
PscI ACATGT 1 cut(s) 49
Psp1406I AACGTT 1 cut(s) 814
Psp5II RGGWCCY 1 cut(s) 170
PspN4I GGNNCC 1 cut(s) 317
PspPI GGNCC 2 cut(s) 170, 503
PspPPI RGGWCCY 1 cut(s) 170
PspXI VCTCGAGB 1 cut(s) 92
RsaI GTAC 1 cut(s) 48
RsaNI GTAC 1 cut(s) 47
RseI CAYNNNNRTG 2 cut(s) 726, 804
SapI GCTCTTC 1 cut(s) 235
SaqAI TTAA 6 cut(s) 14, 122, 146, 423, 857, 863
SatI GCNGC 3 cut(s) 433, 573, 732
Sau96I GGNCC 2 cut(s) 170, 503
Sfr274I CTCGAG 1 cut(s) 92
SfuI TTCGAA 1 cut(s) 789
SinI GGWCC 1 cut(s) 170
SlaI CTCGAG 1 cut(s) 92
SmiMI CAYNNNNRTG 2 cut(s) 726, 804
SmlI CTYRAG 1 cut(s) 92
SmoI CTYRAG 1 cut(s) 92
Sse9I AATT 6 cut(s) 123, 227, 463, 859, 864, 877
SsiI CCGC 3 cut(s) 433, 573, 732
SspMI CTAG 7 cut(s) 63, 246, 356, 429, 542, 588, 726
StyI CCWWGG 2 cut(s) 499, 778
TaiI ACGT 1 cut(s) 817
TaqI TCGA 2 cut(s) 93, 789
TasI AATT 6 cut(s) 123, 227, 463, 859, 864, 877
TauI GCSGC 3 cut(s) 435, 575, 734
TfiI GAWTC 2 cut(s) 519, 591
Tru1I TTAA 6 cut(s) 14, 122, 146, 423, 857, 863
Tru9I TTAA 6 cut(s) 14, 122, 146, 423, 857, 863
VpaK11BI GGWCC 1 cut(s) 170
XapI RAATTY 2 cut(s) 859, 877
XbaI TCTAGA 3 cut(s) 62, 541, 587
XceI RCATGY 2 cut(s) 53, 572
XhoI CTCGAG 1 cut(s) 92
XspI CTAG 7 cut(s) 63, 246, 356, 429, 542, 588, 726
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.