pycom01g00870

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
Physical Location & Seq
Forward (+)
798074 .. 798670
597 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g00870.1

Sequence Viewer

Length: 396 bp
ATGAAATTTAATTGTCTTTGCTTGCCATTTAAGACGTTGGATTGTTGGAGCGTTTCTAGGTGTATTCTATCTTATAATTTCTTTTTAGTTAGAAGTGAATTCAAAGCCATGAACATATATATGAATGTGATTTACTTATCTGTTGGATTGATAACTTATTCTTGTATGTTGATTAAGGATGCATACTTAGTTTTCATGCATGAATTTGGTTGGAGGTTGCTCATCACAATCACGTTAAGTAAATCCATGGCAGGAGTATCATGCACGCCCAGGGGAGTGATCCTTATATGTATATTCCCATCTCTACCTAGCACGAGGCCTTTTGGGAGCTCACTGGCTTCGGGTTCCGTAGGAACTCCGAAGTTAAGCGAGAAGAGGGCTAGAGCAATCCCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

132

Amino Acids

14.7

Weight (kDa)

9.47

Isoelectric Point (pI)

55.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 75
AclWI GGATC 1 cut(s) 274
AcsI RAATTY 3 cut(s) 5, 98, 203
AgsI TTSAA 1 cut(s) 103
AjnI CCWGG 1 cut(s) 269
AluBI AGCT 1 cut(s) 330
AluI AGCT 1 cut(s) 330
Alw21I GWGCWC 1 cut(s) 332
AlwI GGATC 1 cut(s) 274
AoxI GGCC 1 cut(s) 317
ApoI RAATTY 3 cut(s) 5, 98, 203
BanII GRGCYC 1 cut(s) 332
BauI CACGAG 1 cut(s) 313
Bbv12I GWGCWC 1 cut(s) 332
BccI CCATC 1 cut(s) 307
BciT130I CCWGG 1 cut(s) 271
BfaI CTAG 3 cut(s) 57, 309, 381
Bme1390I CCNGG 1 cut(s) 271
BmiI GGNNCC 1 cut(s) 346
BmrFI CCNGG 1 cut(s) 271
BmsI GCATC 1 cut(s) 169
BsaJI CCNNGG 3 cut(s) 246, 269, 270
Bse1I ACTGG 1 cut(s) 339
BseBI CCWGG 1 cut(s) 271
BseDI CCNNGG 3 cut(s) 246, 269, 270
BseGI GGATG 1 cut(s) 184
BseNI ACTGG 1 cut(s) 339
BshFI GGCC 1 cut(s) 319
BsiHKAI GWGCWC 1 cut(s) 332
BsnI GGCC 1 cut(s) 319
Bsp1286I GDGCHC 1 cut(s) 332
Bsp143I GATC 1 cut(s) 279
Bsp19I CCATGG 1 cut(s) 246
BspANI GGCC 1 cut(s) 319
BspLI GGNNCC 1 cut(s) 346
BspPI GGATC 1 cut(s) 274
BsrI ACTGG 1 cut(s) 339
BssECI CCNNGG 3 cut(s) 246, 269, 270
BssMI GATC 1 cut(s) 279
BssSI CACGAG 1 cut(s) 313
BssT1I CCWWGG 1 cut(s) 246
Bst2BI CACGAG 1 cut(s) 313
Bst2UI CCWGG 1 cut(s) 271
Bst6I CTCTTC 1 cut(s) 368
BstC8I GCNNGC 2 cut(s) 23, 266
BstDEI CTNAG 1 cut(s) 187
BstDSI CCRYGG 1 cut(s) 246
BstF5I GGATG 1 cut(s) 184
BstKTI GATC 1 cut(s) 282
BstMBI GATC 1 cut(s) 279
BstNI CCWGG 1 cut(s) 271
BstSCI CCNGG 1 cut(s) 269
BsuRI GGCC 1 cut(s) 319
BtgI CCRYGG 1 cut(s) 246
BtsCI GGATG 1 cut(s) 184
BtsIMutI CAGTG 1 cut(s) 332
Cac8I GCNNGC 2 cut(s) 23, 266
CviAII CATG 6 cut(s) 109, 196, 200, 247, 261, 393
CviJI RGCY 5 cut(s) 107, 319, 330, 338, 380
CviKI_1 RGCY 5 cut(s) 107, 319, 330, 338, 380
DdeI CTNAG 1 cut(s) 187
DpnI GATC 1 cut(s) 281
DpnII GATC 1 cut(s) 279
Eam1104I CTCTTC 1 cut(s) 368
EarI CTCTTC 1 cut(s) 368
Ecl136II GAGCTC 1 cut(s) 330
Eco130I CCWWGG 1 cut(s) 246
Eco147I AGGCCT 1 cut(s) 319
Eco24I GRGCYC 1 cut(s) 332
Eco53kI GAGCTC 1 cut(s) 330
EcoICRI GAGCTC 1 cut(s) 330
EcoRI GAATTC 1 cut(s) 98
EcoRII CCWGG 1 cut(s) 269
EcoT14I CCWWGG 1 cut(s) 246
EcoT22I ATGCAT 2 cut(s) 184, 201
EcoT38I GRGCYC 1 cut(s) 332
ErhI CCWWGG 1 cut(s) 246
FaeI CATG 6 cut(s) 112, 199, 203, 250, 264, 396
FatI CATG 6 cut(s) 108, 195, 199, 246, 260, 392
FokI GGATG 1 cut(s) 191
FriOI GRGCYC 1 cut(s) 332
FspBI CTAG 3 cut(s) 57, 309, 381
HaeIII GGCC 1 cut(s) 319
Hin1II CATG 6 cut(s) 112, 199, 203, 250, 264, 396
Hpy188I TCNGA 1 cut(s) 360
HpyCH4IV ACGT 2 cut(s) 35, 233
HpyCH4V TGCA 3 cut(s) 182, 199, 264
HpyF3I CTNAG 1 cut(s) 187
HpySE526I ACGT 2 cut(s) 35, 233
Hsp92II CATG 6 cut(s) 112, 199, 203, 250, 264, 396
Kzo9I GATC 1 cut(s) 279
LmnI GCTCC 2 cut(s) 48, 327
LpnPI CCDG 4 cut(s) 237, 256, 283, 320
LweI GCATC 1 cut(s) 169
MaeI CTAG 3 cut(s) 57, 309, 381
MaeII ACGT 2 cut(s) 35, 233
MalI GATC 1 cut(s) 281
MboI GATC 1 cut(s) 279
MboII GAAGA 1 cut(s) 385
MhlI GDGCHC 1 cut(s) 332
MluCI AATT 5 cut(s) 5, 10, 76, 98, 203
MmeI TCCRAC 4 cut(s) 18, 26, 124, 191
MnlI CCTC 3 cut(s) 207, 309, 369
Mph1103I ATGCAT 2 cut(s) 184, 201
MseI TTAA 5 cut(s) 9, 30, 174, 236, 365
MslI CAYNNNNRTG 1 cut(s) 119
MspR9I CCNGG 1 cut(s) 271
MvaI CCWGG 1 cut(s) 271
NcoI CCATGG 1 cut(s) 246
NdeII GATC 1 cut(s) 279
NlaIII CATG 6 cut(s) 112, 199, 203, 250, 264, 396
NlaIV GGNNCC 1 cut(s) 346
NsiI ATGCAT 2 cut(s) 184, 201
PasI CCCWGGG 1 cut(s) 270
PceI AGGCCT 1 cut(s) 319
PsiI TTATAA 1 cut(s) 75
Psp124BI GAGCTC 1 cut(s) 332
Psp6I CCWGG 1 cut(s) 269
PspGI CCWGG 1 cut(s) 269
PspN4I GGNNCC 1 cut(s) 346
RseI CAYNNNNRTG 1 cut(s) 119
SacI GAGCTC 1 cut(s) 332
SaqAI TTAA 5 cut(s) 9, 30, 174, 236, 365
Sau3AI GATC 1 cut(s) 279
ScrFI CCNGG 1 cut(s) 271
SduI GDGCHC 1 cut(s) 332
SetI ASST 6 cut(s) 38, 62, 218, 236, 310, 332
SfaNI GCATC 1 cut(s) 169
SmiMI CAYNNNNRTG 1 cut(s) 119
Sse9I AATT 5 cut(s) 5, 10, 76, 98, 203
SseBI AGGCCT 1 cut(s) 319
SspMI CTAG 3 cut(s) 57, 309, 381
SstI GAGCTC 1 cut(s) 332
StuI AGGCCT 1 cut(s) 319
StyD4I CCNGG 1 cut(s) 269
StyI CCWWGG 1 cut(s) 246
TaiI ACGT 2 cut(s) 38, 236
TasI AATT 5 cut(s) 5, 10, 76, 98, 203
Tru1I TTAA 5 cut(s) 9, 30, 174, 236, 365
Tru9I TTAA 5 cut(s) 9, 30, 174, 236, 365
TscAI CASTG 1 cut(s) 339
TspDTI ATGAA 5 cut(s) 17, 125, 137, 184, 216
TspGWI ACGGA 1 cut(s) 337
TspRI CASTG 1 cut(s) 339
XapI RAATTY 3 cut(s) 5, 98, 203
XspI CTAG 3 cut(s) 57, 309, 381
Zsp2I ATGCAT 2 cut(s) 184, 201
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.