pycom12g16740

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
OG0000158
Physical Location & Seq
Forward (+)
19053767 .. 19054682
916 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12g16740.4

Sequence Viewer

Length: 762 bp
ATGAAAAATTCTCTCTTTGTTAAGCGTCAGAACGTACCACTAGATTGTACATACCAAACCCGGCCCGGGGGGGACCACTTCCCGGGCCCGCTCCACCACCGTAGCACGATATTGTCCGCTTTGGGGTTACCATTCCCTCACGGTTTTGTTTTCGGGAACTCACGAGCAACTTCCCAGTGGGTCACCCATCATGGGATTGCTCTAGCCCCCTTCTCGCTTAACTTCGGAGTTCCTACGGAACCCGAAGCCAGTGAGCTCCCAAAATGCCTCGTGCTAGGTAGGGATGAGAATATACATATATCGATCACTCCCCTGGGCGATGTGGGATGTCACAATCCACCCCCCTTAGGGGCCCGACGTCCTCGTCGGCACACACGCGACCAGGGTTTGGCTCTGATACCAAATTGTCACATCCCGGCCCGGGGGGGGACCACTTCCCGGGCCCGCTCCACCACCGTAGCACGATATTGTCCGCTTTGGGCTTACCATTCCCTCACGGTTTTGTTTTCAGGAACTCATGAGCAACTTCCCAGTGGGTCACCCATCATGGGATTGTTCTATGAGCTCCCAAAAGGCCTCGTGCTAGGTAGGGATAGGAATATACATATAAGGATCACTCCCTTGGGCGATGTGGGATGTCACAAAAAACATAACGTACCAAAATTAGTAGTATGTACCGATTATGTACCAAGTTATTGGTATGTTATGTTTGTTAGTTGTATTTTTAGACTTTTAATGATATTTTTTGAAAATTTTGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

254

Amino Acids

28.21

Weight (kDa)

9.34

Isoelectric Point (pI)

61.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 363
AatII GACGTC 1 cut(s) 361
AccB7I CCANNNNNTGG 1 cut(s) 388
AccBSI CCGCTC 2 cut(s) 91, 447
AccII CGCG 1 cut(s) 378
AciI CCGC 4 cut(s) 89, 117, 445, 473
AclWI GGATC 1 cut(s) 620
AcsI RAATTY 2 cut(s) 7, 751
AcyI GRCGYC 1 cut(s) 358
AfaI GTAC 5 cut(s) 36, 49, 657, 676, 687
AgsI TTSAA 1 cut(s) 749
AjnI CCWGG 2 cut(s) 312, 381
AluBI AGCT 2 cut(s) 256, 565
AluI AGCT 2 cut(s) 256, 565
Alw21I GWGCWC 2 cut(s) 258, 567
AlwI GGATC 1 cut(s) 620
Ama87I CYCGRG 4 cut(s) 65, 82, 420, 438
AoxI GGCC 6 cut(s) 62, 85, 351, 417, 441, 574
ApaI GGGCCC 3 cut(s) 89, 355, 445
ApoI RAATTY 2 cut(s) 7, 751
AsuHPI GGTGA 2 cut(s) 175, 531
AvaI CYCGRG 4 cut(s) 65, 82, 420, 438
AvaII GGWCC 2 cut(s) 73, 429
AxyI CCTNAGG 1 cut(s) 346
BaeGI GKGCMC 3 cut(s) 89, 355, 445
BanII GRGCYC 5 cut(s) 89, 258, 355, 445, 567
BauI CACGAG 3 cut(s) 162, 269, 578
Bbv12I GWGCWC 2 cut(s) 258, 567
BccI CCATC 2 cut(s) 195, 551
BciT130I CCWGG 2 cut(s) 314, 383
BfaI CTAG 4 cut(s) 41, 203, 275, 584
Bme18I GGWCC 2 cut(s) 73, 429
BmeT110I CYCGRG 4 cut(s) 65, 82, 420, 438
BmiI GGNNCC 7 cut(s) 74, 87, 240, 352, 353, 430, 443
BmrI ACTGGG 2 cut(s) 169, 525
BmuI ACTGGG 2 cut(s) 169, 525
Bsa29I ATCGAT 1 cut(s) 302
BsaHI GRCGYC 1 cut(s) 358
Bse1I ACTGG 3 cut(s) 175, 249, 531
Bse21I CCTNAGG 1 cut(s) 346
BseBI CCWGG 2 cut(s) 314, 383
BseCI ATCGAT 1 cut(s) 302
BseGI GGATG 4 cut(s) 289, 332, 411, 641
BseNI ACTGG 3 cut(s) 175, 249, 531
BseSI GKGCMC 3 cut(s) 89, 355, 445
Bsh1236I CGCG 1 cut(s) 378
BshFI GGCC 6 cut(s) 64, 87, 353, 419, 443, 576
BshVI ATCGAT 1 cut(s) 302
BsiHKAI GWGCWC 2 cut(s) 258, 567
BsiHKCI CYCGRG 4 cut(s) 65, 82, 420, 438
BsiSI CCGG 6 cut(s) 61, 66, 83, 416, 421, 439
BslFI GGGAC 2 cut(s) 86, 442
BsmFI GGGAC 2 cut(s) 86, 442
BsnI GGCC 6 cut(s) 64, 87, 353, 419, 443, 576
BsoBI CYCGRG 4 cut(s) 65, 82, 420, 438
Bsp120I GGGCCC 3 cut(s) 85, 351, 441
Bsp1286I GDGCHC 5 cut(s) 89, 258, 355, 445, 567
Bsp1407I TGTACA 1 cut(s) 47
Bsp143I GATC 2 cut(s) 303, 612
BspACI CCGC 4 cut(s) 89, 117, 445, 473
BspANI GGCC 6 cut(s) 64, 87, 353, 419, 443, 576
BspDI ATCGAT 1 cut(s) 302
BspFNI CGCG 1 cut(s) 378
BspHI TCATGA 1 cut(s) 517
BspLI GGNNCC 7 cut(s) 74, 87, 240, 352, 353, 430, 443
BspPI GGATC 1 cut(s) 620
BsrBI CCGCTC 2 cut(s) 91, 447
BsrGI TGTACA 1 cut(s) 47
BsrI ACTGG 3 cut(s) 175, 249, 531
BssMI GATC 2 cut(s) 303, 612
BssNI GRCGYC 1 cut(s) 358
BssSI CACGAG 3 cut(s) 162, 269, 578
BssT1I CCWWGG 1 cut(s) 621
Bst2BI CACGAG 3 cut(s) 162, 269, 578
Bst2UI CCWGG 2 cut(s) 314, 383
Bst4CI ACNGT 4 cut(s) 101, 143, 457, 499
BstACI GRCGYC 1 cut(s) 358
BstAUI TGTACA 1 cut(s) 47
BstC8I GCNNGC 2 cut(s) 89, 445
BstDEI CTNAG 1 cut(s) 346
BstEII GGTNACC 3 cut(s) 126, 181, 537
BstF5I GGATG 4 cut(s) 289, 332, 411, 641
BstFNI CGCG 1 cut(s) 378
BstKTI GATC 2 cut(s) 306, 615
BstMBI GATC 2 cut(s) 303, 612
BstNI CCWGG 2 cut(s) 314, 383
BstPI GGTNACC 3 cut(s) 126, 181, 537
BstSLI GKGCMC 3 cut(s) 89, 355, 445
BstUI CGCG 1 cut(s) 378
BstXI CCANNNNNNTGG 1 cut(s) 696
Bsu15I ATCGAT 1 cut(s) 302
Bsu36I CCTNAGG 1 cut(s) 346
BsuRI GGCC 6 cut(s) 64, 87, 353, 419, 443, 576
BsuTUI ATCGAT 1 cut(s) 302
BtgZI GCGATG 2 cut(s) 333, 642
BtsCI GGATG 4 cut(s) 289, 332, 411, 641
BtsIMutI CAGTG 3 cut(s) 182, 256, 538
Cac8I GCNNGC 2 cut(s) 89, 445
CciI TCATGA 1 cut(s) 517
Cfr9I CCCGGG 4 cut(s) 65, 82, 420, 438
ClaI ATCGAT 1 cut(s) 302
CseI GACGC 1 cut(s) 14
Csp6I GTAC 5 cut(s) 35, 48, 656, 675, 686
CviAII CATG 3 cut(s) 191, 518, 547
CviQI GTAC 5 cut(s) 35, 48, 656, 675, 686
DdeI CTNAG 1 cut(s) 346
DpnI GATC 2 cut(s) 305, 614
DpnII GATC 2 cut(s) 303, 612
DrdI GACNNNNNNGTC 1 cut(s) 363
DseDI GACNNNNNNGTC 1 cut(s) 363
Ecl136II GAGCTC 2 cut(s) 256, 565
Eco130I CCWWGG 1 cut(s) 621
Eco147I AGGCCT 1 cut(s) 576
Eco24I GRGCYC 5 cut(s) 89, 258, 355, 445, 567
Eco47I GGWCC 2 cut(s) 73, 429
Eco53kI GAGCTC 2 cut(s) 256, 565
Eco81I CCTNAGG 1 cut(s) 346
Eco88I CYCGRG 4 cut(s) 65, 82, 420, 438
Eco91I GGTNACC 3 cut(s) 126, 181, 537
EcoICRI GAGCTC 2 cut(s) 256, 565
EcoO109I RGGNCCY 1 cut(s) 351
EcoO65I GGTNACC 3 cut(s) 126, 181, 537
EcoRII CCWGG 2 cut(s) 312, 381
EcoT14I CCWWGG 1 cut(s) 621
EcoT38I GRGCYC 5 cut(s) 89, 258, 355, 445, 567
ErhI CCWWGG 1 cut(s) 621
FaeI CATG 3 cut(s) 194, 521, 550
FaqI GGGAC 2 cut(s) 86, 442
FatI CATG 3 cut(s) 190, 517, 546
FauI CCCGC 2 cut(s) 96, 452
FokI GGATG 4 cut(s) 296, 339, 398, 648
FriOI GRGCYC 5 cut(s) 89, 258, 355, 445, 567
FspBI CTAG 4 cut(s) 41, 203, 275, 584
HaeIII GGCC 6 cut(s) 64, 87, 353, 419, 443, 576
HapII CCGG 6 cut(s) 61, 66, 83, 416, 421, 439
HgaI GACGC 1 cut(s) 14
Hin1I GRCGYC 1 cut(s) 358
Hin1II CATG 3 cut(s) 194, 521, 550
HpaII CCGG 6 cut(s) 61, 66, 83, 416, 421, 439
HphI GGTGA 2 cut(s) 175, 531
Hpy188I TCNGA 3 cut(s) 30, 227, 396
Hpy188III TCNNGA 4 cut(s) 154, 162, 510, 518
Hpy99I CGWCG 2 cut(s) 360, 369
HpyAV CCTTC 1 cut(s) 220
HpyCH4III ACNGT 4 cut(s) 101, 143, 457, 499
HpyCH4IV ACGT 3 cut(s) 33, 358, 654
HpyF3I CTNAG 1 cut(s) 346
HpySE526I ACGT 3 cut(s) 33, 358, 654
Hsp92I GRCGYC 1 cut(s) 358
Hsp92II CATG 3 cut(s) 194, 521, 550
Kzo9I GATC 2 cut(s) 303, 612
LmnI GCTCC 4 cut(s) 96, 261, 452, 570
MaeI CTAG 4 cut(s) 41, 203, 275, 584
MaeII ACGT 3 cut(s) 33, 358, 654
MaeIII GTNAC 6 cut(s) 126, 181, 329, 407, 537, 638
MalI GATC 2 cut(s) 305, 614
MbiI CCGCTC 2 cut(s) 91, 447
MboI GATC 2 cut(s) 303, 612
MhlI GDGCHC 5 cut(s) 89, 258, 355, 445, 567
MluCI AATT 4 cut(s) 7, 403, 662, 751
MnlI CCTC 5 cut(s) 147, 278, 372, 503, 587
MseI TTAA 3 cut(s) 21, 219, 734
MspI CCGG 6 cut(s) 61, 66, 83, 416, 421, 439
MvaI CCWGG 2 cut(s) 314, 383
MvnI CGCG 1 cut(s) 378
NdeII GATC 2 cut(s) 303, 612
NlaIII CATG 3 cut(s) 194, 521, 550
NlaIV GGNNCC 7 cut(s) 74, 87, 240, 352, 353, 430, 443
NmuCI GTSAC 5 cut(s) 181, 329, 407, 537, 638
PagI TCATGA 1 cut(s) 517
PasI CCCWGGG 1 cut(s) 313
PceI AGGCCT 1 cut(s) 576
PflMI CCANNNNNTGG 1 cut(s) 388
Psp124BI GAGCTC 2 cut(s) 258, 567
Psp6I CCWGG 2 cut(s) 312, 381
PspEI GGTNACC 3 cut(s) 126, 181, 537
PspGI CCWGG 2 cut(s) 312, 381
PspN4I GGNNCC 7 cut(s) 74, 87, 240, 352, 353, 430, 443
PspOMI GGGCCC 3 cut(s) 85, 351, 441
RsaI GTAC 5 cut(s) 36, 49, 657, 676, 687
RsaNI GTAC 5 cut(s) 35, 48, 656, 675, 686
SacI GAGCTC 2 cut(s) 258, 567
SaqAI TTAA 3 cut(s) 21, 219, 734
Sau3AI GATC 2 cut(s) 303, 612
SduI GDGCHC 5 cut(s) 89, 258, 355, 445, 567
SetI ASST 7 cut(s) 36, 258, 280, 361, 567, 589, 657
SinI GGWCC 2 cut(s) 73, 429
SmaI CCCGGG 4 cut(s) 67, 84, 422, 440
Sse9I AATT 4 cut(s) 7, 403, 662, 751
SseBI AGGCCT 1 cut(s) 576
SsiI CCGC 4 cut(s) 89, 117, 445, 473
SspMI CTAG 4 cut(s) 41, 203, 275, 584
SstI GAGCTC 2 cut(s) 258, 567
StuI AGGCCT 1 cut(s) 576
StyI CCWWGG 1 cut(s) 621
TaaI ACNGT 4 cut(s) 101, 143, 457, 499
TaiI ACGT 3 cut(s) 36, 361, 657
TaqI TCGA 1 cut(s) 302
TasI AATT 4 cut(s) 7, 403, 662, 751
TatI WGTACW 1 cut(s) 47
Tru1I TTAA 3 cut(s) 21, 219, 734
Tru9I TTAA 3 cut(s) 21, 219, 734
TscAI CASTG 3 cut(s) 182, 256, 538
TseFI GTSAC 5 cut(s) 181, 329, 407, 537, 638
Tsp45I GTSAC 5 cut(s) 181, 329, 407, 537, 638
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 251
TspMI CCCGGG 4 cut(s) 65, 82, 420, 438
TspRI CASTG 3 cut(s) 182, 256, 538
Van91I CCANNNNNTGG 1 cut(s) 388
VpaK11BI GGWCC 2 cut(s) 73, 429
XapI RAATTY 2 cut(s) 7, 751
XmaI CCCGGG 4 cut(s) 65, 82, 420, 438
XspI CTAG 4 cut(s) 41, 203, 275, 584
ZraI GACGTC 1 cut(s) 359
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.