pycom13g26620

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
Physical Location & Seq
Forward (+)
23178129 .. 23179067
939 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom13g26620.2

Sequence Viewer

Length: 840 bp
ATGCCATGCACACCAACCTATTTTAGGCCCATTCTATTCACTTCCATACTCTTCTTTATTCCACATGCATTCACACACATGCACATCATTCACTCACATTTCCTAGCCATGCATCACTTTAACCCACATTTTCACCCATTTACACACACACACACCCAAAACACATCAAAGCCGTGCATTACTCCTTCACATTCCAACATTTCCACATGCATTCCTCTTACAATTTCAGCCTTTACACATTTCCTAACCCTACATGTATTATTTATTAGCATATTCACATGCATCACAAAACACCATCTTCCCCTTTACCAAACCCTTTGCCGTGCACATGTTTTCTTTTTGTTTAAATTCCAGCTTTCAAATGCAAACACATGCACAACAACACTATCACAAAACCTGCCATCATTCACCAAACATCCTTTGCTTTACATCTCCACAAACACATGCATTTGCACCACCAAAAACCCCTTTGCCGTGGGCTTTCAATGCCTTTCCAGCTTTCCCTTTTATTTTCCAGCTTTCATTCTTCATCTTTGCAGCCACAAGTCACATGCATTCACTCATAATCATTCATTAAACAAACAGCCCTATGTTCCCTCCACTACTCCTATAAATACCCTAGCATTCATTCATTCACTCCCCATTCAATACACATCTCATTTCATACACAACACACCACAAACACTTCCATTTTCTTTCTTTGCCGTGAGTCCCACTTCATTTCCAGCATCATTCCCTTCTATTTCCACCACTTCCCAACCCTCCAAACCACTCCTCATCCATTTCCATAATCCCCCAAACCTCACCTTAGACCTTGTGCTACAACAACGAGGAAGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

280

Amino Acids

31.84

Weight (kDa)

9.4

Isoelectric Point (pI)

46.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 405
AcsI RAATTY 1 cut(s) 347
AfiI CCNNNNNNNGG 1 cut(s) 24
AflIII ACRYGT 2 cut(s) 253, 328
AgsI TTSAA 3 cut(s) 360, 485, 647
AluBI AGCT 3 cut(s) 355, 498, 518
AluI AGCT 3 cut(s) 355, 498, 518
Alw21I GWGCWC 1 cut(s) 328
Alw44I GTGCAC 1 cut(s) 324
AoxI GGCC 1 cut(s) 26
ApaLI GTGCAC 1 cut(s) 324
ApeKI GCWGC 1 cut(s) 537
ApoI RAATTY 1 cut(s) 347
AspS9I GGNCC 1 cut(s) 27
AsuHPI GGTGA 3 cut(s) 125, 400, 796
BaeGI GKGCMC 1 cut(s) 328
Bbv12I GWGCWC 1 cut(s) 328
BbvI GCAGC 1 cut(s) 549
BccI CCATC 2 cut(s) 303, 409
BceAI ACGGC 4 cut(s) 157, 306, 458, 689
BfaI CTAG 2 cut(s) 104, 620
BfuAI ACCTGC 1 cut(s) 405
BisI GCNGC 1 cut(s) 538
BlsI GCNGC 1 cut(s) 539
BmgT120I GGNCC 1 cut(s) 27
BmsI GCATC 3 cut(s) 121, 291, 737
BsaJI CCNNGG 1 cut(s) 474
Bsc4I CCNNNNNNNGG 1 cut(s) 24
BseDI CCNNGG 1 cut(s) 474
BseGI GGATG 2 cut(s) 415, 777
BseLI CCNNNNNNNGG 1 cut(s) 24
BseRI GAGGAG 1 cut(s) 764
BseSI GKGCMC 1 cut(s) 328
BseXI GCAGC 1 cut(s) 549
BshFI GGCC 1 cut(s) 28
BsiHKAI GWGCWC 1 cut(s) 328
BslFI GGGAC 1 cut(s) 696
BslI CCNNNNNNNGG 1 cut(s) 24
BsmFI GGGAC 1 cut(s) 696
BsmI GAATGC 4 cut(s) 68, 210, 554, 623
BsnI GGCC 1 cut(s) 28
Bsp1286I GDGCHC 1 cut(s) 328
BspANI GGCC 1 cut(s) 28
BspMI ACCTGC 1 cut(s) 405
BssECI CCNNGG 1 cut(s) 474
Bst6I CTCTTC 1 cut(s) 56
BstDEI CTNAG 1 cut(s) 808
BstDSI CCRYGG 1 cut(s) 474
BstENI CCTNNNNNAGG 1 cut(s) 22
BstF5I GGATG 2 cut(s) 415, 777
BstMWI GCNNNNNNNGC 2 cut(s) 486, 495
BstNSI RCATGY 9 cut(s) 68, 82, 210, 257, 282, 332, 375, 447, 554
BstSLI GKGCMC 1 cut(s) 328
BstV1I GCAGC 1 cut(s) 549
BsuRI GGCC 1 cut(s) 28
BtgI CCRYGG 1 cut(s) 474
BtsCI GGATG 2 cut(s) 415, 777
BveI ACCTGC 1 cut(s) 405
Cfr13I GGNCC 1 cut(s) 27
DdeI CTNAG 1 cut(s) 808
DraI TTTAAA 1 cut(s) 346
Eam1104I CTCTTC 1 cut(s) 56
EarI CTCTTC 1 cut(s) 56
EcoNI CCTNNNNNAGG 1 cut(s) 22
EcoT22I ATGCAT 6 cut(s) 70, 114, 212, 284, 449, 556
FaqI GGGAC 1 cut(s) 696
Fnu4HI GCNGC 1 cut(s) 538
FokI GGATG 2 cut(s) 402, 764
Fsp4HI GCNGC 1 cut(s) 538
FspBI CTAG 2 cut(s) 104, 620
GluI GCNGC 1 cut(s) 538
HaeIII GGCC 1 cut(s) 28
HinfI GANTC 1 cut(s) 709
HphI GGTGA 3 cut(s) 125, 400, 796
Hpy166II GTNNAC 1 cut(s) 326
Hpy8I GTNNAC 1 cut(s) 326
HpyAV CCTTC 2 cut(s) 195, 747
HpyF10VI GCNNNNNNNGC 2 cut(s) 486, 495
HpyF3I CTNAG 1 cut(s) 808
LpnPI CCDG 5 cut(s) 365, 410, 508, 528, 738
Lsp1109I GCAGC 1 cut(s) 549
LweI GCATC 3 cut(s) 121, 291, 737
MaeI CTAG 2 cut(s) 104, 620
MaeIII GTNAC 1 cut(s) 546
MboII GAAGA 3 cut(s) 43, 290, 518
MhlI GDGCHC 1 cut(s) 328
MluCI AATT 2 cut(s) 222, 347
MlyI GAGTC 1 cut(s) 718
MmeI TCCRAC 1 cut(s) 219
MnlI CCTC 6 cut(s) 225, 607, 772, 785, 812, 824
Mph1103I ATGCAT 6 cut(s) 70, 114, 212, 284, 449, 556
MseI TTAA 3 cut(s) 120, 345, 575
MslI CAYNNNNRTG 1 cut(s) 77
Mva1269I GAATGC 4 cut(s) 68, 210, 554, 623
MwoI GCNNNNNNNGC 2 cut(s) 486, 495
NmuCI GTSAC 1 cut(s) 546
NsiI ATGCAT 6 cut(s) 70, 114, 212, 284, 449, 556
NspI RCATGY 9 cut(s) 68, 82, 210, 257, 282, 332, 375, 447, 554
PciI ACATGT 2 cut(s) 253, 328
PctI GAATGC 4 cut(s) 68, 210, 554, 623
PkrI GCNGC 1 cut(s) 539
PleI GAGTC 1 cut(s) 717
PpsI GAGTC 1 cut(s) 717
PscI ACATGT 2 cut(s) 253, 328
PspPI GGNCC 1 cut(s) 27
RseI CAYNNNNRTG 1 cut(s) 77
SaqAI TTAA 3 cut(s) 120, 345, 575
SatI GCNGC 1 cut(s) 538
Sau96I GGNCC 1 cut(s) 27
SchI GAGTC 1 cut(s) 718
SduI GDGCHC 1 cut(s) 328
SetI ASST 8 cut(s) 20, 357, 399, 500, 520, 804, 809, 816
SfaNI GCATC 3 cut(s) 121, 291, 737
SmiMI CAYNNNNRTG 1 cut(s) 77
Sse9I AATT 2 cut(s) 222, 347
SspMI CTAG 2 cut(s) 104, 620
TasI AATT 2 cut(s) 222, 347
Tru1I TTAA 3 cut(s) 120, 345, 575
Tru9I TTAA 3 cut(s) 120, 345, 575
TseFI GTSAC 1 cut(s) 546
TseI GCWGC 1 cut(s) 537
Tsp45I GTSAC 1 cut(s) 546
TspDTI ATGAA 7 cut(s) 511, 518, 561, 616, 620, 652, 708
VneI GTGCAC 1 cut(s) 324
XagI CCTNNNNNAGG 1 cut(s) 22
XapI RAATTY 1 cut(s) 347
XceI RCATGY 9 cut(s) 68, 82, 210, 257, 282, 332, 375, 447, 554
XspI CTAG 2 cut(s) 104, 620
Zsp2I ATGCAT 6 cut(s) 70, 114, 212, 284, 449, 556
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.