pycom13g25760

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
OG0000158
Physical Location & Seq
Forward (+)
22506239 .. 22508320
2082 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom13g25760.5

Sequence Viewer

Length: 1479 bp
ATGCCCCATAATAATGAGCAACCAAATATGACCGTAGCTTTAAAATGTTCTCAGGGAAAATATCTTGGTAAGTTGTTAGGTATTTGCATCATTGAAGAACACAACACAAAAATAGAGAAATTCATAAAAAAAAATACTAAGGTTAACTTTGCACTCCTATTATTTCCGATAATGAGAGAAAACACTACTGCTGCCCTTAAGATGTACGTGCACTTGCCGAACCTTGTAAATATTGTGTCTTATTTACTTTATATTCCACTGCAAACGTATCCTCAATTTCACACCACGTTATCAGCACGAGAAGCTCTCGTGTCAATGAAAAGTACAAGAGTAACTAAACTAATTACAAAAGGTCAACTATCCAACAAGACAACCATCATACAAGGTACTAATCTCTTCGTCTTATCGAGGACTATGATTTTCGTTTTTGAATCACTAAATTTCGTTGATTTGACGAATTCCCTTGTTTTCCCACGGACAGCCGTCTTTCAGGCTCTTTTATGGCCATCTCCGGTGACCATTTGGACTCCAAGCAGGTATAATTTTGTTCTACACTTCTCTAGCTTCAATTTGGTATATTATAGGTCAAATTTGGTGATGTGGGCATATCTATGCACCTTATTTTATGTATTTTCAGGATTTAAGGGCAAAGTATGCAAAAGGATGCATTTTGGAGCTATTTGGAGCATTTTTGGGCATGGATTGGATAGCTTAACCATGGAGCAAAGAGGATGGACGAAATTGAAGTCAAAAAGGGCTAGGAAAGGCTACAAATCTGGTGGAAGAAGTCCTAATGCAATGAAGATAAGGAAGAAGCAAGAAACAAGGAACCTTATCCAACCTTATCAACCTTATCTTATCCTATCCCTAACATTATCCTATTCTATCCTATCCAAATCTGTTAAACACCTAAGTCAGTTTCTAGAGGCCTTATCCACTCAAATGCCGCAAGAACACCATTCCTTCCTAGACCCTTTAGGTTTAGGAATCTGCCCTAAACCATCCCTTCTAGAGACCTTATCTCATCCCTCTAAACATGCCGCACCAAAACCTTCTAGAATCCCTAAATCCTATAACCCTTTTTCAATGGGATTAGGCAATCCTTTTCCTTCACTAAGTGTACCACCACCCCTTCACACATTCATTCACTCCTCCACATTCAGAAATTCGCCAAGAAATACATTCCCAACCCTTGCCGCAGCCATCCTTCACCATTCTCCATATTTTCCCACCTTGCCACACTCCCCATCCCTCCTAAACACTACCCTACTATCACACATCCATTCCTCCATACAAATACCACCCAAAAACCTGTCCTTAGACCTTGTGCCGCAACAAAGAGGAGGAGAAGAGGGCTTGGACGTTCATGCAATTCAAGTTCGAGTTGCTGGAATTTTTAGGTGTTTCCTCTCCTTTAATTTCAATGGGGGGATTCGAAACCATGATCATGCTTTCAATTTACTTATCTATTTGAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

493

Amino Acids

55.78

Weight (kDa)

10.05

Isoelectric Point (pI)

39.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 525
AciI CCGC 4 cut(s) 947, 1041, 1197, 1331
AcoI YGGCCR 1 cut(s) 503
AcsI RAATTY 6 cut(s) 119, 439, 457, 589, 1165, 1392
AdeI CACNNNGTG 1 cut(s) 1118
AfaI GTAC 4 cut(s) 206, 325, 388, 1122
AflII CTTAAG 1 cut(s) 197
AgsI TTSAA 9 cut(s) 95, 431, 568, 745, 1086, 1376, 1423, 1456, 1474
AluBI AGCT 5 cut(s) 38, 305, 564, 677, 711
AluI AGCT 5 cut(s) 38, 305, 564, 677, 711
Alw21I GWGCWC 1 cut(s) 213
Alw26I GTCTC 1 cut(s) 1007
Alw44I GTGCAC 1 cut(s) 209
AoxI GGCC 2 cut(s) 503, 927
ApaLI GTGCAC 1 cut(s) 209
ApeKI GCWGC 2 cut(s) 191, 1199
ApoI RAATTY 6 cut(s) 119, 439, 457, 589, 1165, 1392
ArsI GACNNNNNNTTYG 2 cut(s) 731, 763
AsuHPI GGTGA 3 cut(s) 526, 607, 1202
AsuII TTCGAA 1 cut(s) 1435
BaeGI GKGCMC 1 cut(s) 213
BalI TGGCCA 1 cut(s) 505
BauI CACGAG 2 cut(s) 297, 308
Bbv12I GWGCWC 1 cut(s) 213
BbvI GCAGC 2 cut(s) 178, 1211
BccI CCATC 6 cut(s) 383, 514, 726, 1009, 1211, 1255
BceAI ACGGC 1 cut(s) 467
BciVI GTATCC 1 cut(s) 279
BclI TGATCA 1 cut(s) 1444
BcoDI GTCTC 1 cut(s) 1007
BfaI CTAG 6 cut(s) 561, 759, 923, 968, 1010, 1056
BfrI CTTAAG 1 cut(s) 197
BfuAI ACCTGC 1 cut(s) 525
BfuI GTATCC 1 cut(s) 279
BisI GCNGC 6 cut(s) 192, 947, 1041, 1197, 1200, 1331
BlsI GCNGC 6 cut(s) 193, 948, 1042, 1198, 1201, 1332
BmiI GGNNCC 1 cut(s) 830
BmsI GCATC 2 cut(s) 96, 654
BoxI GACNNNNGTC 1 cut(s) 482
BplI GAGNNNNNCTC 2 cut(s) 291, 323
Bpu14I TTCGAA 1 cut(s) 1435
BsaAI YACGTR 1 cut(s) 208
BsaI GGTCTC 1 cut(s) 1007
BsaJI CCNNGG 2 cut(s) 473, 717
BsaWI WCCGGW 1 cut(s) 511
Bse3DI GCAATG 1 cut(s) 804
BseDI CCNNGG 2 cut(s) 473, 717
BseGI GGATG 7 cut(s) 669, 737, 1001, 1024, 1203, 1247, 1278
BseMI GCAATG 1 cut(s) 804
BseMII CTCAG 1 cut(s) 65
BseRI GAGGAG 3 cut(s) 1141, 1356, 1359
BseSI GKGCMC 1 cut(s) 213
BseXI GCAGC 2 cut(s) 178, 1211
BshFI GGCC 2 cut(s) 505, 929
BsiHKAI GWGCWC 1 cut(s) 213
BsiSI CCGG 1 cut(s) 512
BsmAI GTCTC 1 cut(s) 1007
BsnI GGCC 2 cut(s) 505, 929
Bso31I GGTCTC 1 cut(s) 1007
Bsp119I TTCGAA 1 cut(s) 1435
Bsp1286I GDGCHC 1 cut(s) 213
Bsp143I GATC 1 cut(s) 1444
Bsp19I CCATGG 1 cut(s) 717
BspACI CCGC 4 cut(s) 947, 1041, 1197, 1331
BspANI GGCC 2 cut(s) 505, 929
BspCNI CTCAG 1 cut(s) 64
BspLI GGNNCC 1 cut(s) 830
BspMI ACCTGC 1 cut(s) 525
BspT104I TTCGAA 1 cut(s) 1435
BspTI CTTAAG 1 cut(s) 197
BspTNI GGTCTC 1 cut(s) 1007
BsrDI GCAATG 1 cut(s) 804
BssECI CCNNGG 2 cut(s) 473, 717
BssMI GATC 1 cut(s) 1444
BssSI CACGAG 2 cut(s) 297, 308
BssT1I CCWWGG 1 cut(s) 717
Bst2BI CACGAG 2 cut(s) 297, 308
Bst4CI ACNGT 1 cut(s) 34
Bst6I CTCTTC 2 cut(s) 401, 1344
BstAFI CTTAAG 1 cut(s) 197
BstAPI GCANNNNNTGC 1 cut(s) 654
BstBAI YACGTR 1 cut(s) 208
BstBI TTCGAA 1 cut(s) 1435
BstDEI CTNAG 5 cut(s) 51, 138, 911, 1115, 1318
BstDSI CCRYGG 2 cut(s) 473, 717
BstEII GGTNACC 1 cut(s) 514
BstF5I GGATG 7 cut(s) 669, 737, 1001, 1024, 1203, 1247, 1278
BstKTI GATC 1 cut(s) 1447
BstMAI GTCTC 1 cut(s) 1007
BstMBI GATC 1 cut(s) 1444
BstMWI GCNNNNNNNGC 2 cut(s) 302, 654
BstNSI RCATGY 1 cut(s) 1040
BstPAI GACNNNNGTC 1 cut(s) 482
BstPI GGTNACC 1 cut(s) 514
BstSLI GKGCMC 1 cut(s) 213
BstV1I GCAGC 2 cut(s) 178, 1211
BsuI GTATCC 1 cut(s) 279
BsuRI GGCC 2 cut(s) 505, 929
BtgI CCRYGG 2 cut(s) 473, 717
BtsCI GGATG 7 cut(s) 669, 737, 1001, 1024, 1203, 1247, 1278
BtsI GCAGTG 1 cut(s) 257
BtsIMutI CAGTG 1 cut(s) 257
BveI ACCTGC 1 cut(s) 525
Csp6I GTAC 4 cut(s) 205, 324, 387, 1121
CspCI CAANNNNNGTGG 2 cut(s) 760, 795
CviAII CATG 6 cut(s) 698, 718, 1037, 1367, 1442, 1448
CviQI GTAC 4 cut(s) 205, 324, 387, 1121
DdeI CTNAG 5 cut(s) 51, 138, 911, 1115, 1318
DpnI GATC 1 cut(s) 1446
DpnII GATC 1 cut(s) 1444
DraI TTTAAA 1 cut(s) 42
DraIII CACNNNGTG 1 cut(s) 1118
EaeI YGGCCR 1 cut(s) 503
Eam1104I CTCTTC 2 cut(s) 401, 1344
EarI CTCTTC 2 cut(s) 401, 1344
Eco130I CCWWGG 1 cut(s) 717
Eco147I AGGCCT 1 cut(s) 929
Eco31I GGTCTC 1 cut(s) 1007
Eco91I GGTNACC 1 cut(s) 514
EcoO65I GGTNACC 1 cut(s) 514
EcoRI GAATTC 1 cut(s) 457
EcoT14I CCWWGG 1 cut(s) 717
EcoT22I ATGCAT 1 cut(s) 669
ErhI CCWWGG 1 cut(s) 717
FaeI CATG 6 cut(s) 701, 721, 1040, 1370, 1445, 1451
FalI AAGNNNNNCTT 2 cut(s) 131, 163
FatI CATG 6 cut(s) 697, 717, 1036, 1366, 1441, 1447
FbaI TGATCA 1 cut(s) 1444
Fnu4HI GCNGC 6 cut(s) 192, 947, 1041, 1197, 1200, 1331
FokI GGATG 7 cut(s) 676, 744, 988, 1011, 1190, 1234, 1265
Fsp4HI GCNGC 6 cut(s) 192, 947, 1041, 1197, 1200, 1331
FspBI CTAG 6 cut(s) 561, 759, 923, 968, 1010, 1056
GluI GCNGC 6 cut(s) 192, 947, 1041, 1197, 1200, 1331
HaeIII GGCC 2 cut(s) 505, 929
HapII CCGG 1 cut(s) 512
Hin1II CATG 6 cut(s) 701, 721, 1040, 1370, 1445, 1451
HincII GTYRAC 2 cut(s) 145, 356
HindII GTYRAC 2 cut(s) 145, 356
HinfI GANTC 5 cut(s) 431, 526, 987, 1059, 1432
HpaI GTTAAC 1 cut(s) 145
HpaII CCGG 1 cut(s) 512
HphI GGTGA 3 cut(s) 526, 607, 1202
Hpy166II GTNNAC 4 cut(s) 145, 211, 356, 1121
Hpy188I TCNGA 2 cut(s) 168, 1163
Hpy188III TCNNGA 4 cut(s) 636, 923, 1010, 1056
Hpy8I GTNNAC 4 cut(s) 145, 211, 356, 1121
HpyAV CCTTC 6 cut(s) 973, 1016, 1062, 1119, 1142, 1217
HpyCH4III ACNGT 1 cut(s) 34
HpyCH4IV ACGT 4 cut(s) 207, 266, 287, 1362
HpyCH4V TGCA 9 cut(s) 87, 152, 211, 262, 615, 657, 667, 797, 1370
HpyF10VI GCNNNNNNNGC 2 cut(s) 302, 654
HpyF3I CTNAG 5 cut(s) 51, 138, 911, 1115, 1318
HpySE526I ACGT 4 cut(s) 207, 266, 287, 1362
Hsp92II CATG 6 cut(s) 701, 721, 1040, 1370, 1445, 1451
Ksp22I TGATCA 1 cut(s) 1444
KspAI GTTAAC 1 cut(s) 145
Kzo9I GATC 1 cut(s) 1444
LmnI GCTCC 3 cut(s) 674, 684, 721
LpnPI CCDG 8 cut(s) 38, 476, 520, 525, 621, 762, 1325, 1374
Lsp1109I GCAGC 2 cut(s) 178, 1211
LweI GCATC 2 cut(s) 96, 654
MaeI CTAG 6 cut(s) 561, 759, 923, 968, 1010, 1056
MaeII ACGT 4 cut(s) 207, 266, 287, 1362
MaeIII GTNAC 2 cut(s) 331, 514
MalI GATC 1 cut(s) 1446
MboI GATC 1 cut(s) 1444
MboII GAAGA 6 cut(s) 107, 388, 795, 814, 823, 1361
MhlI GDGCHC 1 cut(s) 213
MlsI TGGCCA 1 cut(s) 505
MluNI TGGCCA 1 cut(s) 505
MlyI GAGTC 1 cut(s) 520
MmeI TCCRAC 2 cut(s) 387, 862
Mox20I TGGCCA 1 cut(s) 505
Mph1103I ATGCAT 1 cut(s) 669
MscI TGGCCA 1 cut(s) 505
MseI TTAA 8 cut(s) 41, 144, 198, 642, 713, 903, 1416, 1477
MslI CAYNNNNRTG 4 cut(s) 12, 610, 941, 1446
Msp20I TGGCCA 1 cut(s) 505
MspCI CTTAAG 1 cut(s) 197
MspI CCGG 1 cut(s) 512
MwoI GCNNNNNNNGC 2 cut(s) 302, 654
NcoI CCATGG 1 cut(s) 717
NdeII GATC 1 cut(s) 1444
NlaIII CATG 6 cut(s) 701, 721, 1040, 1370, 1445, 1451
NlaIV GGNNCC 1 cut(s) 830
NmuCI GTSAC 1 cut(s) 514
NsiI ATGCAT 1 cut(s) 669
NspI RCATGY 1 cut(s) 1040
NspV TTCGAA 1 cut(s) 1435
PceI AGGCCT 1 cut(s) 929
PfeI GAWTC 4 cut(s) 431, 987, 1059, 1432
PkrI GCNGC 6 cut(s) 193, 948, 1042, 1198, 1201, 1332
PleI GAGTC 1 cut(s) 520
PpsI GAGTC 1 cut(s) 520
Ppu21I YACGTR 1 cut(s) 208
PshAI GACNNNNGTC 1 cut(s) 482
PspEI GGTNACC 1 cut(s) 514
PspN4I GGNNCC 1 cut(s) 830
RsaI GTAC 4 cut(s) 206, 325, 388, 1122
RsaNI GTAC 4 cut(s) 205, 324, 387, 1121
RseI CAYNNNNRTG 4 cut(s) 12, 610, 941, 1446
SaqAI TTAA 8 cut(s) 41, 144, 198, 642, 713, 903, 1416, 1477
SatI GCNGC 6 cut(s) 192, 947, 1041, 1197, 1200, 1331
Sau3AI GATC 1 cut(s) 1444
SchI GAGTC 1 cut(s) 520
SduI GDGCHC 1 cut(s) 213
SfaNI GCATC 2 cut(s) 96, 654
SfuI TTCGAA 1 cut(s) 1435
SmiMI CAYNNNNRTG 4 cut(s) 12, 610, 941, 1446
SmlI CTYRAG 1 cut(s) 197
SmoI CTYRAG 1 cut(s) 197
SseBI AGGCCT 1 cut(s) 929
SsiI CCGC 4 cut(s) 947, 1041, 1197, 1331
SspI AATATT 1 cut(s) 232
SspMI CTAG 6 cut(s) 561, 759, 923, 968, 1010, 1056
StuI AGGCCT 1 cut(s) 929
StyI CCWWGG 1 cut(s) 717
TaaI ACNGT 1 cut(s) 34
TaiI ACGT 4 cut(s) 210, 269, 290, 1365
TaqI TCGA 3 cut(s) 407, 1381, 1435
TatI WGTACW 1 cut(s) 323
TauI GCSGC 4 cut(s) 949, 1043, 1199, 1333
TfiI GAWTC 4 cut(s) 431, 987, 1059, 1432
Tru1I TTAA 8 cut(s) 41, 144, 198, 642, 713, 903, 1416, 1477
Tru9I TTAA 8 cut(s) 41, 144, 198, 642, 713, 903, 1416, 1477
TscAI CASTG 1 cut(s) 264
TseFI GTSAC 1 cut(s) 514
TseI GCWGC 2 cut(s) 191, 1199
Tsp45I GTSAC 1 cut(s) 514
TspDTI ATGAA 5 cut(s) 112, 332, 815, 1132, 1355
TspGWI ACGGA 1 cut(s) 490
TspRI CASTG 1 cut(s) 264
Vha464I CTTAAG 1 cut(s) 197
VneI GTGCAC 1 cut(s) 209
XapI RAATTY 6 cut(s) 119, 439, 457, 589, 1165, 1392
XbaI TCTAGA 3 cut(s) 922, 1009, 1055
XceI RCATGY 1 cut(s) 1040
XspI CTAG 6 cut(s) 561, 759, 923, 968, 1010, 1056
Zsp2I ATGCAT 1 cut(s) 669
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.