pycom15g04370

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
Physical Location & Seq
Forward (+)
2613178 .. 2614296
1119 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom15g04370.5

Sequence Viewer

Length: 819 bp
ATGACGTGTCTAGTATGTTTTGTTTTATTTTTTGAATATCAATGTACCCATTTTTTTGTTTTGAAAAAGATTAATGTTGTCGCATCCCAGTTTCGGCTTCGTCGTAGCATGATATTGTCTGCTTTGGGCTTACCATTCCCTCACTGTTTTTGTTTTTTTTTTGGGAACTCACGAGCAACTTCCCAGTGGGTCACCCATCTTGGGATTGCTCTTTATGTACATATAAGACACATTACCCCTTCTCCGTTGGTTGATGTGGGATCTCACAAATGTACCTACTTAATACTAGTAGTTTTGGTTACTTTGAAAAATAATGCACCTGTTATCAAATTTTTGAATCTGGAAAATATAGGTAATTATCGGCATATTATTGATATTTCTCATATAAATATATTTATTAGGCATACTATTGATGTTTCTCATATAAATATATGGGTTTTTTTATTAACATCGCACATGTTGTTGATTACACCCCACTTAAAAATTGTAGAACAAAACCCTAAAAACACAAACAAGTTGATGAAAATATATCTTTTGATGGACGGAACAAAAAATCAAGTTTTGCTCCTCGTTCATTCCCCTGCTCTAGTTGGAATCCAAGAAATAGGAAGAAAACTAGAGAATGTTGTAAAATTTTACGATGTAATACATGTAATATTCTTATGGCAGTTTGATGATGAAGAAATTCAATTTCCTACCGTTTGTCCATCAAGCTTCTTAGAATCCAACATGATTGTTCAAGAAAATTTGACAGATGTTTATAAATCAAACGGCAAGATGGAGATTTTATACAATTTAATTCATCTTTCTTGTCTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

273

Amino Acids

31.48

Weight (kDa)

8.59

Isoelectric Point (pI)

50.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 762
AclWI GGATC 1 cut(s) 268
AcsI RAATTY 4 cut(s) 329, 632, 684, 745
AfaI GTAC 3 cut(s) 46, 219, 274
AfiI CCNNNNNNNGG 2 cut(s) 93, 201
AflIII ACRYGT 3 cut(s) 5, 456, 649
AgsI TTSAA 6 cut(s) 35, 64, 307, 337, 689, 740
AhlI ACTAGT 1 cut(s) 286
AjiI CACGTC 1 cut(s) 6
AluBI AGCT 1 cut(s) 714
AluI AGCT 1 cut(s) 714
AlwI GGATC 1 cut(s) 268
ApoI RAATTY 4 cut(s) 329, 632, 684, 745
AseI ATTAAT 1 cut(s) 72
Asp700I GAANNNNTTC 1 cut(s) 684
AsuHPI GGTGA 1 cut(s) 184
BaeI ACNNNNGTAYC 2 cut(s) 256, 289
BauI CACGAG 1 cut(s) 171
BccI CCATC 4 cut(s) 204, 532, 715, 772
BceAI ACGGC 1 cut(s) 787
BcuI ACTAGT 1 cut(s) 286
BfaI CTAG 4 cut(s) 11, 287, 587, 617
BmgBI CACGTC 1 cut(s) 6
BmrI ACTGGG 2 cut(s) 82, 178
BmsI GCATC 1 cut(s) 92
BmuI ACTGGG 2 cut(s) 82, 178
BsaXI ACNNNNNCTCC 2 cut(s) 226, 256
Bsc4I CCNNNNNNNGG 2 cut(s) 93, 201
Bse1I ACTGG 2 cut(s) 88, 184
BseGI GGATG 1 cut(s) 83
BseLI CCNNNNNNNGG 2 cut(s) 93, 201
BseNI ACTGG 2 cut(s) 88, 184
BseRI GAGGAG 1 cut(s) 557
BslI CCNNNNNNNGG 2 cut(s) 93, 201
Bsp1407I TGTACA 1 cut(s) 217
Bsp143I GATC 1 cut(s) 260
BspPI GGATC 1 cut(s) 268
BsrGI TGTACA 1 cut(s) 217
BsrI ACTGG 2 cut(s) 88, 184
BssMI GATC 1 cut(s) 260
BssSI CACGAG 1 cut(s) 171
Bst2BI CACGAG 1 cut(s) 171
Bst4CI ACNGT 2 cut(s) 146, 700
BstAUI TGTACA 1 cut(s) 217
BstDEI CTNAG 1 cut(s) 718
BstEII GGTNACC 1 cut(s) 190
BstF5I GGATG 1 cut(s) 83
BstKTI GATC 1 cut(s) 263
BstMBI GATC 1 cut(s) 260
BstNSI RCATGY 2 cut(s) 460, 653
BstPI GGTNACC 1 cut(s) 190
BstX2I RGATCY 1 cut(s) 260
BstYI RGATCY 1 cut(s) 260
BtgZI GCGATG 1 cut(s) 435
BtrI CACGTC 1 cut(s) 6
BtsCI GGATG 1 cut(s) 83
BtsIMutI CAGTG 2 cut(s) 142, 191
Csp6I GTAC 3 cut(s) 45, 218, 273
CviAII CATG 4 cut(s) 109, 457, 650, 730
CviJI RGCY 3 cut(s) 97, 129, 714
CviKI_1 RGCY 3 cut(s) 97, 129, 714
CviQI GTAC 3 cut(s) 45, 218, 273
DdeI CTNAG 1 cut(s) 718
DpnI GATC 1 cut(s) 262
DpnII GATC 1 cut(s) 260
Eco91I GGTNACC 1 cut(s) 190
EcoO65I GGTNACC 1 cut(s) 190
FaeI CATG 4 cut(s) 112, 460, 653, 733
FatI CATG 4 cut(s) 108, 456, 649, 729
FokI GGATG 1 cut(s) 70
FspBI CTAG 4 cut(s) 11, 287, 587, 617
Hin1II CATG 4 cut(s) 112, 460, 653, 733
HindIII AAGCTT 1 cut(s) 712
HinfI GANTC 3 cut(s) 337, 594, 722
HphI GGTGA 1 cut(s) 184
Hpy188III TCNNGA 3 cut(s) 171, 341, 740
Hpy99I CGWCG 1 cut(s) 105
HpyAV CCTTC 1 cut(s) 249
HpyCH4III ACNGT 2 cut(s) 146, 700
HpyCH4IV ACGT 1 cut(s) 5
HpyCH4V TGCA 1 cut(s) 317
HpyF3I CTNAG 1 cut(s) 718
HpySE526I ACGT 1 cut(s) 5
Hsp92II CATG 4 cut(s) 112, 460, 653, 733
Kzo9I GATC 1 cut(s) 260
LmnI GCTCC 1 cut(s) 570
LpnPI CCDG 5 cut(s) 101, 197, 326, 333, 594
LweI GCATC 1 cut(s) 92
MaeI CTAG 4 cut(s) 11, 287, 587, 617
MaeII ACGT 1 cut(s) 5
MaeIII GTNAC 2 cut(s) 190, 298
MalI GATC 1 cut(s) 262
MboI GATC 1 cut(s) 260
MboII GAAGA 2 cut(s) 621, 692
MflI RGATCY 1 cut(s) 260
MluCI AATT 9 cut(s) 329, 355, 483, 632, 684, 689, 745, 793, 798
MmeI TCCRAC 2 cut(s) 571, 750
MnlI CCTC 2 cut(s) 150, 578
MroXI GAANNNNTTC 1 cut(s) 684
MseI TTAA 6 cut(s) 72, 281, 446, 479, 797, 817
NdeII GATC 1 cut(s) 260
NlaIII CATG 4 cut(s) 112, 460, 653, 733
NmuCI GTSAC 1 cut(s) 190
NspI RCATGY 2 cut(s) 460, 653
PciI ACATGT 2 cut(s) 456, 649
PcsI WCGNNNNNNNCGW 1 cut(s) 100
PdmI GAANNNNTTC 1 cut(s) 684
PfeI GAWTC 3 cut(s) 337, 594, 722
PscI ACATGT 2 cut(s) 456, 649
PshBI ATTAAT 1 cut(s) 72
PsiI TTATAA 1 cut(s) 762
PspEI GGTNACC 1 cut(s) 190
PsuI RGATCY 1 cut(s) 260
RsaI GTAC 3 cut(s) 46, 219, 274
RsaNI GTAC 3 cut(s) 45, 218, 273
SaqAI TTAA 6 cut(s) 72, 281, 446, 479, 797, 817
Sau3AI GATC 1 cut(s) 260
SetI ASST 5 cut(s) 8, 278, 322, 355, 716
SfaNI GCATC 1 cut(s) 92
SpeI ACTAGT 1 cut(s) 286
Sse9I AATT 9 cut(s) 329, 355, 483, 632, 684, 689, 745, 793, 798
SspI AATATT 1 cut(s) 657
SspMI CTAG 4 cut(s) 11, 287, 587, 617
TaaI ACNGT 2 cut(s) 146, 700
TaiI ACGT 1 cut(s) 8
TasI AATT 9 cut(s) 329, 355, 483, 632, 684, 689, 745, 793, 798
TatI WGTACW 1 cut(s) 217
TfiI GAWTC 3 cut(s) 337, 594, 722
Tru1I TTAA 6 cut(s) 72, 281, 446, 479, 797, 817
Tru9I TTAA 6 cut(s) 72, 281, 446, 479, 797, 817
TscAI CASTG 2 cut(s) 149, 191
TseFI GTSAC 1 cut(s) 190
Tsp45I GTSAC 1 cut(s) 190
TspDTI ATGAA 4 cut(s) 536, 563, 693, 791
TspGWI ACGGA 2 cut(s) 234, 558
TspRI CASTG 2 cut(s) 149, 191
VspI ATTAAT 1 cut(s) 72
XapI RAATTY 4 cut(s) 329, 632, 684, 745
XceI RCATGY 2 cut(s) 460, 653
XmnI GAANNNNTTC 1 cut(s) 684
XspI CTAG 4 cut(s) 11, 287, 587, 617
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.