pycom09g12120

Receptor-like protein 2

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr9
OG0000158
Physical Location & Seq
Forward (+)
10479821 .. 10480198
378 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom09g12120.1

Sequence Viewer

Length: 378 bp
ATGTCACAATCCACCCCCCTTAGGGGCCCGACGTCCTCGTCGACACACACGCGACCAAGGTTAGGCTCTGATACCAAATTGTCACATCTCGGCCCGGGCGGGACCACTTCCCGGGCCCGACTCCACCACCGTAGCACGATATTGTCCGCTTTGGGCTTACCATTCCCTCACGGTTTTGTTTTTGGGAACTCACAAGCAACTTCCCAGTGGGTCACCCATCATGGGATTGCTCTAGCCCCCTTCTCGCTTAACTTCGGAGTTCCTACGGAACCCGAAGCCAGTGAGCTCCCAAAAGGCCTCGTGCTAGGTAGGAATTGGAATATACATTTAAGAATCACTCCCCTGGGCGATGTGGGATGTCACATTATGATCCCTTAA

Protein Analysis

126

Amino Acids

13.39

Weight (kDa)

11.21

Isoelectric Point (pI)

53.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 37
AatII GACGTC 1 cut(s) 35
AccI GTMKAC 1 cut(s) 41
AccII CGCG 1 cut(s) 52
AciI CCGC 2 cut(s) 99, 147
AclWI GGATC 1 cut(s) 364
AcyI GRCGYC 1 cut(s) 32
AfiI CCNNNNNNNGG 6 cut(s) 21, 22, 23, 62, 111, 222
AjnI CCWGG 1 cut(s) 342
AluBI AGCT 1 cut(s) 286
AluI AGCT 1 cut(s) 286
Alw21I GWGCWC 1 cut(s) 288
AlwI GGATC 1 cut(s) 364
Ama87I CYCGRG 2 cut(s) 94, 111
AoxI GGCC 4 cut(s) 25, 91, 114, 295
ApaI GGGCCC 2 cut(s) 29, 118
AspS9I GGNCC 6 cut(s) 25, 26, 92, 102, 114, 115
AsuC2I CCSGG 4 cut(s) 95, 96, 112, 113
AsuHPI GGTGA 1 cut(s) 205
AvaI CYCGRG 2 cut(s) 94, 111
AvaII GGWCC 1 cut(s) 102
AxyI CCTNAGG 1 cut(s) 20
BaeGI GKGCMC 2 cut(s) 29, 118
BanII GRGCYC 3 cut(s) 29, 118, 288
BauI CACGAG 1 cut(s) 299
Bbv12I GWGCWC 1 cut(s) 288
BccI CCATC 1 cut(s) 225
BciT130I CCWGG 1 cut(s) 344
BcnI CCSGG 4 cut(s) 95, 96, 112, 113
BfaI CTAG 2 cut(s) 233, 305
Bme1390I CCNGG 5 cut(s) 95, 96, 112, 113, 344
Bme18I GGWCC 1 cut(s) 102
BmeT110I CYCGRG 2 cut(s) 94, 111
BmgT120I GGNCC 6 cut(s) 25, 26, 92, 102, 114, 115
BmiI GGNNCC 5 cut(s) 26, 27, 103, 116, 270
BmrFI CCNGG 5 cut(s) 95, 96, 112, 113, 344
BmrI ACTGGG 1 cut(s) 199
BmuI ACTGGG 1 cut(s) 199
BpuMI CCSGG 4 cut(s) 95, 96, 112, 113
BsaHI GRCGYC 1 cut(s) 32
BsaJI CCNNGG 5 cut(s) 56, 94, 111, 342, 343
Bsc4I CCNNNNNNNGG 6 cut(s) 21, 22, 23, 62, 111, 222
Bse1I ACTGG 2 cut(s) 205, 279
Bse21I CCTNAGG 1 cut(s) 20
BseBI CCWGG 1 cut(s) 344
BseDI CCNNGG 5 cut(s) 56, 94, 111, 342, 343
BseGI GGATG 1 cut(s) 362
BseLI CCNNNNNNNGG 6 cut(s) 21, 22, 23, 62, 111, 222
BseNI ACTGG 2 cut(s) 205, 279
BseSI GKGCMC 2 cut(s) 29, 118
Bsh1236I CGCG 1 cut(s) 52
BshFI GGCC 4 cut(s) 27, 93, 116, 297
BsiHKAI GWGCWC 1 cut(s) 288
BsiHKCI CYCGRG 2 cut(s) 94, 111
BsiSI CCGG 2 cut(s) 95, 112
BslFI GGGAC 1 cut(s) 115
BslI CCNNNNNNNGG 6 cut(s) 21, 22, 23, 62, 111, 222
BsmFI GGGAC 1 cut(s) 115
BsnI GGCC 4 cut(s) 27, 93, 116, 297
BsoBI CYCGRG 2 cut(s) 94, 111
Bsp120I GGGCCC 2 cut(s) 25, 114
Bsp1286I GDGCHC 3 cut(s) 29, 118, 288
Bsp143I GATC 1 cut(s) 369
BspACI CCGC 2 cut(s) 99, 147
BspANI GGCC 4 cut(s) 27, 93, 116, 297
BspFNI CGCG 1 cut(s) 52
BspLI GGNNCC 5 cut(s) 26, 27, 103, 116, 270
BspPI GGATC 1 cut(s) 364
BsrI ACTGG 2 cut(s) 205, 279
BssECI CCNNGG 5 cut(s) 56, 94, 111, 342, 343
BssMI GATC 1 cut(s) 369
BssNI GRCGYC 1 cut(s) 32
BssSI CACGAG 1 cut(s) 299
BssT1I CCWWGG 1 cut(s) 56
Bst2BI CACGAG 1 cut(s) 299
Bst2UI CCWGG 1 cut(s) 344
Bst4CI ACNGT 2 cut(s) 131, 173
BstACI GRCGYC 1 cut(s) 32
BstDEI CTNAG 1 cut(s) 20
BstEII GGTNACC 1 cut(s) 211
BstF5I GGATG 1 cut(s) 362
BstFNI CGCG 1 cut(s) 52
BstKTI GATC 1 cut(s) 372
BstMBI GATC 1 cut(s) 369
BstNI CCWGG 1 cut(s) 344
BstPI GGTNACC 1 cut(s) 211
BstSCI CCNGG 5 cut(s) 93, 94, 110, 111, 342
BstSLI GKGCMC 2 cut(s) 29, 118
BstUI CGCG 1 cut(s) 52
Bsu36I CCTNAGG 1 cut(s) 20
BsuRI GGCC 4 cut(s) 27, 93, 116, 297
BtgZI GCGATG 1 cut(s) 363
BtsCI GGATG 1 cut(s) 362
BtsIMutI CAGTG 2 cut(s) 212, 286
Cfr13I GGNCC 6 cut(s) 25, 26, 92, 102, 114, 115
Cfr9I CCCGGG 2 cut(s) 94, 111
CviAII CATG 1 cut(s) 221
CviJI RGCY 9 cut(s) 27, 66, 93, 116, 156, 236, 278, 286, 297
CviKI_1 RGCY 9 cut(s) 27, 66, 93, 116, 156, 236, 278, 286, 297
DdeI CTNAG 1 cut(s) 20
DpnI GATC 1 cut(s) 371
DpnII GATC 1 cut(s) 369
DrdI GACNNNNNNGTC 1 cut(s) 37
DseDI GACNNNNNNGTC 1 cut(s) 37
Ecl136II GAGCTC 1 cut(s) 286
Eco130I CCWWGG 1 cut(s) 56
Eco147I AGGCCT 1 cut(s) 297
Eco24I GRGCYC 3 cut(s) 29, 118, 288
Eco47I GGWCC 1 cut(s) 102
Eco53kI GAGCTC 1 cut(s) 286
Eco81I CCTNAGG 1 cut(s) 20
Eco88I CYCGRG 2 cut(s) 94, 111
Eco91I GGTNACC 1 cut(s) 211
EcoICRI GAGCTC 1 cut(s) 286
EcoO109I RGGNCCY 1 cut(s) 25
EcoO65I GGTNACC 1 cut(s) 211
EcoRII CCWGG 1 cut(s) 342
EcoT14I CCWWGG 1 cut(s) 56
EcoT38I GRGCYC 3 cut(s) 29, 118, 288
ErhI CCWWGG 1 cut(s) 56
FaeI CATG 1 cut(s) 224
FaiI YATR 3 cut(s) 222, 323, 368
FaqI GGGAC 1 cut(s) 115
FatI CATG 1 cut(s) 220
FauI CCCGC 1 cut(s) 92
FblI GTMKAC 1 cut(s) 41
FokI GGATG 1 cut(s) 369
FriOI GRGCYC 3 cut(s) 29, 118, 288
FspBI CTAG 2 cut(s) 233, 305
HaeIII GGCC 4 cut(s) 27, 93, 116, 297
HapII CCGG 2 cut(s) 95, 112
Hin1I GRCGYC 1 cut(s) 32
Hin1II CATG 1 cut(s) 224
HincII GTYRAC 1 cut(s) 42
HindII GTYRAC 1 cut(s) 42
HinfI GANTC 2 cut(s) 120, 333
HpaII CCGG 2 cut(s) 95, 112
HphI GGTGA 1 cut(s) 205
Hpy166II GTNNAC 1 cut(s) 42
Hpy188I TCNGA 2 cut(s) 70, 257
Hpy8I GTNNAC 1 cut(s) 42
Hpy99I CGWCG 2 cut(s) 34, 43
HpyAV CCTTC 1 cut(s) 250
HpyCH4III ACNGT 2 cut(s) 131, 173
HpyCH4IV ACGT 1 cut(s) 32
HpyF3I CTNAG 1 cut(s) 20
HpySE526I ACGT 1 cut(s) 32
Hsp92I GRCGYC 1 cut(s) 32
Hsp92II CATG 1 cut(s) 224
Kzo9I GATC 1 cut(s) 369
LmnI GCTCC 1 cut(s) 291
LpnPI CCDG 6 cut(s) 108, 125, 218, 292, 329, 356
MaeI CTAG 2 cut(s) 233, 305
MaeII ACGT 1 cut(s) 32
MaeIII GTNAC 4 cut(s) 3, 81, 211, 359
MalI GATC 1 cut(s) 371
MboI GATC 1 cut(s) 369
MhlI GDGCHC 3 cut(s) 29, 118, 288
MluCI AATT 2 cut(s) 77, 313
MlyI GAGTC 1 cut(s) 114
MnlI CCTC 3 cut(s) 46, 177, 308
MseI TTAA 3 cut(s) 249, 329, 376
MspI CCGG 2 cut(s) 95, 112
MspR9I CCNGG 5 cut(s) 95, 96, 112, 113, 344
MvaI CCWGG 1 cut(s) 344
MvnI CGCG 1 cut(s) 52
NciI CCSGG 4 cut(s) 95, 96, 112, 113
NdeII GATC 1 cut(s) 369
NlaIII CATG 1 cut(s) 224
NlaIV GGNNCC 5 cut(s) 26, 27, 103, 116, 270
NmeAIII GCCGAG 1 cut(s) 69
NmuCI GTSAC 4 cut(s) 3, 81, 211, 359
PasI CCCWGGG 1 cut(s) 343
PceI AGGCCT 1 cut(s) 297
PcsI WCGNNNNNNNCGW 1 cut(s) 38
PfeI GAWTC 1 cut(s) 333
PleI GAGTC 1 cut(s) 114
PpsI GAGTC 1 cut(s) 114
Psp124BI GAGCTC 1 cut(s) 288
Psp6I CCWGG 1 cut(s) 342
PspEI GGTNACC 1 cut(s) 211
PspGI CCWGG 1 cut(s) 342
PspN4I GGNNCC 5 cut(s) 26, 27, 103, 116, 270
PspOMI GGGCCC 2 cut(s) 25, 114
PspPI GGNCC 6 cut(s) 25, 26, 92, 102, 114, 115
SacI GAGCTC 1 cut(s) 288
SalI GTCGAC 1 cut(s) 40
SaqAI TTAA 3 cut(s) 249, 329, 376
Sau3AI GATC 1 cut(s) 369
Sau96I GGNCC 6 cut(s) 25, 26, 92, 102, 114, 115
SchI GAGTC 1 cut(s) 114
ScrFI CCNGG 5 cut(s) 95, 96, 112, 113, 344
SduI GDGCHC 3 cut(s) 29, 118, 288
SetI ASST 4 cut(s) 35, 62, 288, 310
SinI GGWCC 1 cut(s) 102
SmaI CCCGGG 2 cut(s) 96, 113
SrfI GCCCGGGC 1 cut(s) 96
Sse9I AATT 2 cut(s) 77, 313
SseBI AGGCCT 1 cut(s) 297
SsiI CCGC 2 cut(s) 99, 147
SspMI CTAG 2 cut(s) 233, 305
SstI GAGCTC 1 cut(s) 288
StuI AGGCCT 1 cut(s) 297
StyD4I CCNGG 5 cut(s) 93, 94, 110, 111, 342
StyI CCWWGG 1 cut(s) 56
TaaI ACNGT 2 cut(s) 131, 173
TaiI ACGT 1 cut(s) 35
TaqI TCGA 1 cut(s) 41
TasI AATT 2 cut(s) 77, 313
TfiI GAWTC 1 cut(s) 333
Tru1I TTAA 3 cut(s) 249, 329, 376
Tru9I TTAA 3 cut(s) 249, 329, 376
TscAI CASTG 2 cut(s) 212, 286
TseFI GTSAC 4 cut(s) 3, 81, 211, 359
Tsp45I GTSAC 4 cut(s) 3, 81, 211, 359
TspGWI ACGGA 1 cut(s) 281
TspMI CCCGGG 2 cut(s) 94, 111
TspRI CASTG 2 cut(s) 212, 286
VpaK11BI GGWCC 1 cut(s) 102
XmaI CCCGGG 2 cut(s) 94, 111
XmiI GTMKAC 1 cut(s) 41
XspI CTAG 2 cut(s) 233, 305
ZraI GACGTC 1 cut(s) 33
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.