pycom03g12060

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr3
OG0000158
Physical Location & Seq
Forward (+)
12424671 .. 12426391
1721 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom03g12060.2

Sequence Viewer

Length: 468 bp
ATGATACTAATTGTCACATCCCGGGCCCGACTCCACCATCGTAGCACGATATTGTCCGCTTTGGGCCCCGACCACGCCCTCACGGTTTTGTTTCTGGGAACTCACCCGAGAACTTCCCAATGGGTCACCCATCATGGGAGTGCTCTTGCGCGCTACTCGCTTAACTTCGGAGTTCCCATGGAACTCGAAGCCAGTGAGCTCCCAAAATGCCTCATGCTAGGTAGGGATGAGAATATACATATAAGGATCACTCCCTTGGGCGATGTGAGATCTTACACTAATTGTATTAGAGGCAAAGTTTTATTGCCAACAGAAAGTTACATAACAGATGCCGAAAACAGATGTACAGAGGAAACGTGGGCCATCCAAAATAAAACACCAAGAGCCCAACCATACATTAGGTTCAGAAACAAAAGCAAACAGAAAGAAACAGTAAACCCTAGCCTCCTGCAACTGTCGCTGCCGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

156

Amino Acids

17.57

Weight (kDa)

9.55

Isoelectric Point (pI)

39.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 151
AciI CCGC 1 cut(s) 57
AclWI GGATC 1 cut(s) 254
AfaI GTAC 1 cut(s) 346
AfiI CCNNNNNNNGG 1 cut(s) 135
AluBI AGCT 1 cut(s) 199
AluI AGCT 1 cut(s) 199
Alw21I GWGCWC 2 cut(s) 145, 201
AlwI GGATC 1 cut(s) 254
Ama87I CYCGRG 2 cut(s) 21, 106
AoxI GGCC 3 cut(s) 24, 64, 360
ApaI GGGCCC 2 cut(s) 28, 68
ApeKI GCWGC 1 cut(s) 460
AspLEI GCGC 2 cut(s) 151, 153
AspS9I GGNCC 5 cut(s) 24, 25, 64, 65, 360
AsuC2I CCSGG 2 cut(s) 22, 23
AsuHPI GGTGA 2 cut(s) 95, 118
AvaI CYCGRG 2 cut(s) 21, 106
BaeGI GKGCMC 2 cut(s) 28, 68
BanII GRGCYC 4 cut(s) 28, 68, 201, 388
Bbv12I GWGCWC 2 cut(s) 145, 201
BbvI GCAGC 1 cut(s) 447
BccI CCATC 3 cut(s) 45, 138, 371
BceAI ACGGC 1 cut(s) 448
BcnI CCSGG 2 cut(s) 22, 23
BfaI CTAG 2 cut(s) 218, 441
BglII AGATCT 1 cut(s) 269
BisI GCNGC 1 cut(s) 461
BlsI GCNGC 1 cut(s) 462
Bme1390I CCNGG 2 cut(s) 22, 23
BmeT110I CYCGRG 2 cut(s) 21, 106
BmgT120I GGNCC 5 cut(s) 24, 25, 64, 65, 360
BmiI GGNNCC 3 cut(s) 26, 66, 67
BmrFI CCNGG 2 cut(s) 22, 23
BmsI GCATC 1 cut(s) 319
BpuMI CCSGG 2 cut(s) 22, 23
BsaJI CCNNGG 3 cut(s) 21, 177, 255
Bsc4I CCNNNNNNNGG 1 cut(s) 135
Bse1I ACTGG 1 cut(s) 192
BseDI CCNNGG 3 cut(s) 21, 177, 255
BseGI GGATG 3 cut(s) 17, 232, 363
BseLI CCNNNNNNNGG 1 cut(s) 135
BseNI ACTGG 1 cut(s) 192
BsePI GCGCGC 1 cut(s) 149
BseSI GKGCMC 2 cut(s) 28, 68
BseXI GCAGC 1 cut(s) 447
Bsh1236I CGCG 1 cut(s) 151
BshFI GGCC 3 cut(s) 26, 66, 362
BsiHKAI GWGCWC 2 cut(s) 145, 201
BsiHKCI CYCGRG 2 cut(s) 21, 106
BsiSI CCGG 1 cut(s) 22
BslI CCNNNNNNNGG 1 cut(s) 135
BsnI GGCC 3 cut(s) 26, 66, 362
BsoBI CYCGRG 2 cut(s) 21, 106
Bsp120I GGGCCC 2 cut(s) 24, 64
Bsp1286I GDGCHC 5 cut(s) 28, 68, 145, 201, 388
Bsp1407I TGTACA 1 cut(s) 344
Bsp143I GATC 2 cut(s) 246, 269
Bsp19I CCATGG 1 cut(s) 177
BspACI CCGC 1 cut(s) 57
BspANI GGCC 3 cut(s) 26, 66, 362
BspFNI CGCG 1 cut(s) 151
BspLI GGNNCC 3 cut(s) 26, 66, 67
BspPI GGATC 1 cut(s) 254
BsrGI TGTACA 1 cut(s) 344
BsrI ACTGG 1 cut(s) 192
BssECI CCNNGG 3 cut(s) 21, 177, 255
BssHII GCGCGC 1 cut(s) 149
BssMI GATC 2 cut(s) 246, 269
BssT1I CCWWGG 2 cut(s) 177, 255
Bst4CI ACNGT 3 cut(s) 85, 433, 456
BstAUI TGTACA 1 cut(s) 344
BstC8I GCNNGC 1 cut(s) 151
BstDSI CCRYGG 1 cut(s) 177
BstEII GGTNACC 1 cut(s) 124
BstF5I GGATG 3 cut(s) 17, 232, 363
BstFNI CGCG 1 cut(s) 151
BstHHI GCGC 2 cut(s) 151, 153
BstKTI GATC 2 cut(s) 249, 272
BstMBI GATC 2 cut(s) 246, 269
BstMWI GCNNNNNNNGC 2 cut(s) 157, 457
BstPI GGTNACC 1 cut(s) 124
BstSCI CCNGG 2 cut(s) 20, 21
BstSLI GKGCMC 2 cut(s) 28, 68
BstUI CGCG 1 cut(s) 151
BstV1I GCAGC 1 cut(s) 447
BstX2I RGATCY 1 cut(s) 269
BstYI RGATCY 1 cut(s) 269
BsuRI GGCC 3 cut(s) 26, 66, 362
BtgI CCRYGG 1 cut(s) 177
BtgZI GCGATG 1 cut(s) 276
BtsCI GGATG 3 cut(s) 17, 232, 363
BtsIMutI CAGTG 1 cut(s) 199
Cac8I GCNNGC 1 cut(s) 151
CfoI GCGC 2 cut(s) 151, 153
Cfr13I GGNCC 5 cut(s) 24, 25, 64, 65, 360
Cfr9I CCCGGG 1 cut(s) 21
Csp6I GTAC 1 cut(s) 345
CviAII CATG 3 cut(s) 134, 178, 214
CviJI RGCY 7 cut(s) 26, 66, 191, 199, 362, 386, 444
CviKI_1 RGCY 7 cut(s) 26, 66, 191, 199, 362, 386, 444
CviQI GTAC 1 cut(s) 345
DpnI GATC 2 cut(s) 248, 271
DpnII GATC 2 cut(s) 246, 269
Ecl136II GAGCTC 1 cut(s) 199
Eco130I CCWWGG 2 cut(s) 177, 255
Eco24I GRGCYC 4 cut(s) 28, 68, 201, 388
Eco53kI GAGCTC 1 cut(s) 199
Eco88I CYCGRG 2 cut(s) 21, 106
Eco91I GGTNACC 1 cut(s) 124
EcoICRI GAGCTC 1 cut(s) 199
EcoO109I RGGNCCY 1 cut(s) 65
EcoO65I GGTNACC 1 cut(s) 124
EcoT14I CCWWGG 2 cut(s) 177, 255
EcoT38I GRGCYC 4 cut(s) 28, 68, 201, 388
ErhI CCWWGG 2 cut(s) 177, 255
FaeI CATG 3 cut(s) 137, 181, 217
FaiI YATR 8 cut(s) 135, 179, 215, 236, 240, 242, 323, 394
FatI CATG 3 cut(s) 133, 177, 213
Fnu4HI GCNGC 1 cut(s) 461
FokI GGATG 3 cut(s) 4, 239, 350
FriOI GRGCYC 4 cut(s) 28, 68, 201, 388
Fsp4HI GCNGC 1 cut(s) 461
FspBI CTAG 2 cut(s) 218, 441
GlaI GCGC 2 cut(s) 150, 152
GluI GCNGC 1 cut(s) 461
HaeIII GGCC 3 cut(s) 26, 66, 362
HapII CCGG 1 cut(s) 22
HhaI GCGC 2 cut(s) 151, 153
Hin1II CATG 3 cut(s) 137, 181, 217
Hin6I GCGC 2 cut(s) 149, 151
HinP1I GCGC 2 cut(s) 149, 151
HinfI GANTC 1 cut(s) 30
HpaII CCGG 1 cut(s) 22
HphI GGTGA 2 cut(s) 95, 118
Hpy166II GTNNAC 1 cut(s) 436
Hpy188I TCNGA 2 cut(s) 170, 407
Hpy8I GTNNAC 1 cut(s) 436
HpyCH4III ACNGT 3 cut(s) 85, 433, 456
HpyCH4IV ACGT 1 cut(s) 356
HpyCH4V TGCA 1 cut(s) 451
HpyF10VI GCNNNNNNNGC 2 cut(s) 157, 457
HpySE526I ACGT 1 cut(s) 356
Hsp92II CATG 3 cut(s) 137, 181, 217
HspAI GCGC 2 cut(s) 149, 151
Kzo9I GATC 2 cut(s) 246, 269
LmnI GCTCC 1 cut(s) 204
LpnPI CCDG 4 cut(s) 35, 80, 205, 461
Lsp1109I GCAGC 1 cut(s) 447
LweI GCATC 1 cut(s) 319
MaeI CTAG 2 cut(s) 218, 441
MaeII ACGT 1 cut(s) 356
MaeIII GTNAC 3 cut(s) 13, 124, 317
MalI GATC 2 cut(s) 248, 271
MboI GATC 2 cut(s) 246, 269
MflI RGATCY 1 cut(s) 269
MhlI GDGCHC 5 cut(s) 28, 68, 145, 201, 388
MluCI AATT 2 cut(s) 9, 280
MlyI GAGTC 1 cut(s) 24
MnlI CCTC 5 cut(s) 89, 221, 284, 343, 455
MseI TTAA 1 cut(s) 162
MslI CAYNNNNRTG 1 cut(s) 138
MspI CCGG 1 cut(s) 22
MspR9I CCNGG 2 cut(s) 22, 23
MvnI CGCG 1 cut(s) 151
MwoI GCNNNNNNNGC 2 cut(s) 157, 457
NciI CCSGG 2 cut(s) 22, 23
NcoI CCATGG 1 cut(s) 177
NdeII GATC 2 cut(s) 246, 269
NlaIII CATG 3 cut(s) 137, 181, 217
NlaIV GGNNCC 3 cut(s) 26, 66, 67
NmuCI GTSAC 2 cut(s) 13, 124
PauI GCGCGC 1 cut(s) 149
PkrI GCNGC 1 cut(s) 462
PleI GAGTC 1 cut(s) 24
PpsI GAGTC 1 cut(s) 24
Psp124BI GAGCTC 1 cut(s) 201
PspEI GGTNACC 1 cut(s) 124
PspN4I GGNNCC 3 cut(s) 26, 66, 67
PspOMI GGGCCC 2 cut(s) 24, 64
PspPI GGNCC 5 cut(s) 24, 25, 64, 65, 360
PsuI RGATCY 1 cut(s) 269
PteI GCGCGC 1 cut(s) 149
RsaI GTAC 1 cut(s) 346
RsaNI GTAC 1 cut(s) 345
RseI CAYNNNNRTG 1 cut(s) 138
SacI GAGCTC 1 cut(s) 201
SaqAI TTAA 1 cut(s) 162
SatI GCNGC 1 cut(s) 461
Sau3AI GATC 2 cut(s) 246, 269
Sau96I GGNCC 5 cut(s) 24, 25, 64, 65, 360
SchI GAGTC 1 cut(s) 24
ScrFI CCNGG 2 cut(s) 22, 23
SduI GDGCHC 5 cut(s) 28, 68, 145, 201, 388
SetI ASST 4 cut(s) 201, 223, 359, 404
SfaNI GCATC 1 cut(s) 319
SmaI CCCGGG 1 cut(s) 23
SmiMI CAYNNNNRTG 1 cut(s) 138
Sse9I AATT 2 cut(s) 9, 280
SsiI CCGC 1 cut(s) 57
SspMI CTAG 2 cut(s) 218, 441
SstI GAGCTC 1 cut(s) 201
StyD4I CCNGG 2 cut(s) 20, 21
StyI CCWWGG 2 cut(s) 177, 255
TaaI ACNGT 3 cut(s) 85, 433, 456
TaiI ACGT 1 cut(s) 359
TaqI TCGA 1 cut(s) 186
TasI AATT 2 cut(s) 9, 280
TatI WGTACW 1 cut(s) 344
Tru1I TTAA 1 cut(s) 162
Tru9I TTAA 1 cut(s) 162
TscAI CASTG 1 cut(s) 199
TseFI GTSAC 2 cut(s) 13, 124
TseI GCWGC 1 cut(s) 460
Tsp45I GTSAC 2 cut(s) 13, 124
TspMI CCCGGG 1 cut(s) 21
TspRI CASTG 1 cut(s) 199
XmaI CCCGGG 1 cut(s) 21
XspI CTAG 2 cut(s) 218, 441
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.