pycom13g24480

Ribosomal protein-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
OG0000158
Physical Location & Seq
Forward (+)
21607504 .. 21609181
1678 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom13g24480.2

Sequence Viewer

Length: 1149 bp
ATGAGCTTTAAGGGTATGAAAGACTTGAATTTCAGCGAATTTAGAATTTATTTTGAGTTCATGCCATCTTTAATTGTTAATTTTATGCATGTGTTGCTCAAATGTTCTAAGTTAGACAAAAGTTTCCCTTTACATTCGCCGCCCCCATCACATATATTTTACTTAGTTACTCGGCCTACGTGCCACGTAGGCTTTGTAATTTTTAGGGTCAACACTAGAGGTGGAGGTCTGATACATGGAACTCTCTTCAACGGCAGATGTTCTCCAACTTTGTTTGATATCCTTAATGAACGCCAATTCCTTTTCCTAGGGATCCTGCAATCAGGTACATTTATCGTACATCATGGGTTTAAATTATTTTTGAGCTCACGATGTACGATGAATGGACATGATTGCGGGATCCCTAGGATCCTTGGAAAAAGGATCTGCACTAAATGTGATGTGTTTCTGATCACGTGTGGTACTTATGGGTTTAGCTTGCAGGAATTGATTTCTCTATCAGACTTTTTTTTCCTACCCACCCAACCAAAAAAGGTTCATGACCGAATTGCTTCACCTAACGATTTTTTAAGGCATTATTACTTTCAACAAAAGCTAAATGTTGTTTATAAAAACTCAGTTTGTCACCCCATCATACTCAGTTTGAATTACTTTCACCATAAAAGGACTTCTACTATTGTTTTAGAGGCAATAGACTTGTTTGATACTTGGATATTGTGTCACATCCCGGCCCGGGACGGATCGATTTCCCGGGCCCGCTCCACCACCGTAGCACGATATTGTCCGCTTTGGGCTTACCATTCCCTCACAGTTTTGTTTTTGGGAACTCACGAGCAACTTCCTAGTGGGTCACCCATCATGGGATTGCTCTATGAGCTCCCAAAAGGCCTCGTGCTAGGTAGGGATGGGAATATACATATAAGGATCACTCCCCTGGGCGATGTGGGATGTCACATATTGCATCCTTTTTTTGGAACTCTTGGGCCGCACAACGGCATCAACATGCCTGGACAATCAATAGTGATTAATGAACTCGTTTCAAGTAGAGCACCTCAAGTGGTTTTTAACATCAACGAGCGTGACTACTGTAGACATCAAAATTCCAGTGAAATAAACATCTCACAAATCGCACACATGGTATGTGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Plant_tran

Protein Analysis

383

Amino Acids

43.38

Weight (kDa)

8.98

Isoelectric Point (pI)

53.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 609
AccBSI CCGCTC 1 cut(s) 759
AccI GTMKAC 1 cut(s) 1090
AciI CCGC 5 cut(s) 140, 396, 757, 785, 986
AclWI GGATC 9 cut(s) 307, 320, 394, 403, 407, 416, 431, 748, 932
AcsI RAATTY 4 cut(s) 28, 38, 45, 1099
AcvI CACGTG 1 cut(s) 456
AfaI GTAC 4 cut(s) 328, 339, 376, 463
AfiI CCNNNNNNNGG 4 cut(s) 733, 860, 971, 992
AflIII ACRYGT 1 cut(s) 455
AgsI TTSAA 5 cut(s) 28, 250, 587, 646, 1041
AjnI CCWGG 2 cut(s) 933, 1006
AloI GAACNNNNNNTCC 2 cut(s) 282, 314
AluBI AGCT 5 cut(s) 6, 366, 477, 595, 877
AluI AGCT 5 cut(s) 6, 366, 477, 595, 877
Alw21I GWGCWC 3 cut(s) 368, 879, 1051
AlwI GGATC 9 cut(s) 307, 320, 394, 403, 407, 416, 431, 748, 932
Ama87I CYCGRG 2 cut(s) 732, 750
AoxI GGCC 5 cut(s) 173, 729, 753, 886, 983
ApaI GGGCCC 1 cut(s) 757
ApoI RAATTY 4 cut(s) 28, 38, 45, 1099
AseI ATTAAT 1 cut(s) 1026
Asp700I GAANNNNTTC 1 cut(s) 550
AspA2I CCTAGG 2 cut(s) 307, 404
AspS9I GGNCC 4 cut(s) 730, 753, 754, 983
AsuC2I CCSGG 5 cut(s) 728, 733, 734, 751, 752
AsuHPI GGTGA 4 cut(s) 546, 617, 647, 843
AvaI CYCGRG 2 cut(s) 732, 750
AvrII CCTAGG 2 cut(s) 307, 404
BaeGI GKGCMC 1 cut(s) 757
BamHI GGATCC 3 cut(s) 312, 399, 408
BanII GRGCYC 3 cut(s) 368, 757, 879
BauI CACGAG 2 cut(s) 830, 890
BbrPI CACGTG 1 cut(s) 456
Bbv12I GWGCWC 3 cut(s) 368, 879, 1051
BccI CCATC 5 cut(s) 73, 154, 638, 863, 899
BceAI ACGGC 2 cut(s) 268, 1009
BciT130I CCWGG 2 cut(s) 935, 1008
BclI TGATCA 1 cut(s) 450
BcnI CCSGG 5 cut(s) 728, 733, 734, 751, 752
BfaI CTAG 5 cut(s) 216, 308, 405, 843, 896
BfmI CTRYAG 1 cut(s) 1087
BglI GCCNNNNNGGC 1 cut(s) 189
BisI GCNGC 2 cut(s) 140, 986
BlnI CCTAGG 2 cut(s) 307, 404
BlsI GCNGC 2 cut(s) 141, 987
Bme1390I CCNGG 7 cut(s) 728, 733, 734, 751, 752, 935, 1008
BmeT110I CYCGRG 2 cut(s) 732, 750
BmgT120I GGNCC 4 cut(s) 730, 753, 754, 983
BmiI GGNNCC 4 cut(s) 314, 401, 410, 755
BmrFI CCNGG 7 cut(s) 728, 733, 734, 751, 752, 935, 1008
BmsI GCATC 2 cut(s) 970, 1005
BpuEI CTTGAG 1 cut(s) 1038
BpuMI CCSGG 5 cut(s) 728, 733, 734, 751, 752
Bsa29I ATCGAT 1 cut(s) 743
BsaAI YACGTR 3 cut(s) 180, 187, 456
BsaJI CCNNGG 7 cut(s) 307, 404, 412, 732, 750, 933, 934
Bsc4I CCNNNNNNNGG 4 cut(s) 733, 860, 971, 992
Bse1I ACTGG 1 cut(s) 1104
BseBI CCWGG 2 cut(s) 935, 1008
BseCI ATCGAT 1 cut(s) 743
BseDI CCNNGG 7 cut(s) 307, 404, 412, 732, 750, 933, 934
BseGI GGATG 4 cut(s) 723, 910, 953, 961
BseLI CCNNNNNNNGG 4 cut(s) 733, 860, 971, 992
BseMII CTCAG 2 cut(s) 630, 652
BseNI ACTGG 1 cut(s) 1104
BseSI GKGCMC 1 cut(s) 757
BsgI GTGCAG 1 cut(s) 412
BshFI GGCC 5 cut(s) 175, 731, 755, 888, 985
BshVI ATCGAT 1 cut(s) 743
BsiHKAI GWGCWC 3 cut(s) 368, 879, 1051
BsiHKCI CYCGRG 2 cut(s) 732, 750
BsiSI CCGG 3 cut(s) 728, 733, 751
BslFI GGGAC 1 cut(s) 749
BslI CCNNNNNNNGG 4 cut(s) 733, 860, 971, 992
BsmFI GGGAC 1 cut(s) 749
BsnI GGCC 5 cut(s) 175, 731, 755, 888, 985
BsoBI CYCGRG 2 cut(s) 732, 750
Bsp120I GGGCCC 1 cut(s) 753
Bsp1286I GDGCHC 4 cut(s) 368, 757, 879, 1051
Bsp143I GATC 7 cut(s) 312, 399, 408, 423, 450, 740, 924
BspACI CCGC 5 cut(s) 140, 396, 757, 785, 986
BspANI GGCC 5 cut(s) 175, 731, 755, 888, 985
BspCNI CTCAG 2 cut(s) 629, 651
BspDI ATCGAT 1 cut(s) 743
BspHI TCATGA 1 cut(s) 538
BspLI GGNNCC 4 cut(s) 314, 401, 410, 755
BspPI GGATC 9 cut(s) 307, 320, 394, 403, 407, 416, 431, 748, 932
BsrBI CCGCTC 1 cut(s) 759
BsrI ACTGG 1 cut(s) 1104
BssECI CCNNGG 7 cut(s) 307, 404, 412, 732, 750, 933, 934
BssMI GATC 7 cut(s) 312, 399, 408, 423, 450, 740, 924
BssSI CACGAG 2 cut(s) 830, 890
BssT1I CCWWGG 3 cut(s) 307, 404, 412
Bst2BI CACGAG 2 cut(s) 830, 890
Bst2UI CCWGG 2 cut(s) 935, 1008
Bst4CI ACNGT 3 cut(s) 769, 811, 1088
Bst6I CTCTTC 1 cut(s) 251
BstAPI GCANNNNNTGC 1 cut(s) 94
BstBAI YACGTR 3 cut(s) 180, 187, 456
BstC8I GCNNGC 2 cut(s) 479, 757
BstDEI CTNAG 4 cut(s) 108, 163, 616, 638
BstEII GGTNACC 1 cut(s) 849
BstF5I GGATG 4 cut(s) 723, 910, 953, 961
BstKTI GATC 7 cut(s) 315, 402, 411, 426, 453, 743, 927
BstMBI GATC 7 cut(s) 312, 399, 408, 423, 450, 740, 924
BstMWI GCNNNNNNNGC 3 cut(s) 94, 189, 874
BstNI CCWGG 2 cut(s) 935, 1008
BstNSI RCATGY 2 cut(s) 92, 1006
BstPI GGTNACC 1 cut(s) 849
BstSCI CCNGG 7 cut(s) 726, 731, 732, 749, 750, 933, 1006
BstSFI CTRYAG 1 cut(s) 1087
BstSLI GKGCMC 1 cut(s) 757
BstX2I RGATCY 4 cut(s) 312, 399, 408, 423
BstYI RGATCY 4 cut(s) 312, 399, 408, 423
Bsu15I ATCGAT 1 cut(s) 743
BsuRI GGCC 5 cut(s) 175, 731, 755, 888, 985
BsuTUI ATCGAT 1 cut(s) 743
BtgZI GCGATG 1 cut(s) 954
BtsCI GGATG 4 cut(s) 723, 910, 953, 961
BtsIMutI CAGTG 1 cut(s) 1111
Cac8I GCNNGC 2 cut(s) 479, 757
CciI TCATGA 1 cut(s) 538
Cfr13I GGNCC 4 cut(s) 730, 753, 754, 983
Cfr9I CCCGGG 2 cut(s) 732, 750
ClaI ATCGAT 1 cut(s) 743
Csp6I GTAC 4 cut(s) 327, 338, 375, 462
CviAII CATG 9 cut(s) 61, 89, 236, 344, 389, 539, 859, 1003, 1135
CviQI GTAC 4 cut(s) 327, 338, 375, 462
DdeI CTNAG 4 cut(s) 108, 163, 616, 638
DpnI GATC 7 cut(s) 314, 401, 410, 425, 452, 742, 926
DpnII GATC 7 cut(s) 312, 399, 408, 423, 450, 740, 924
DraI TTTAAA 1 cut(s) 352
Eam1104I CTCTTC 1 cut(s) 251
EarI CTCTTC 1 cut(s) 251
Ecl136II GAGCTC 2 cut(s) 366, 877
Eco130I CCWWGG 3 cut(s) 307, 404, 412
Eco147I AGGCCT 1 cut(s) 888
Eco24I GRGCYC 3 cut(s) 368, 757, 879
Eco32I GATATC 1 cut(s) 280
Eco53kI GAGCTC 2 cut(s) 366, 877
Eco72I CACGTG 1 cut(s) 456
Eco88I CYCGRG 2 cut(s) 732, 750
Eco91I GGTNACC 1 cut(s) 849
EcoICRI GAGCTC 2 cut(s) 366, 877
EcoO65I GGTNACC 1 cut(s) 849
EcoRII CCWGG 2 cut(s) 933, 1006
EcoRV GATATC 1 cut(s) 280
EcoT14I CCWWGG 3 cut(s) 307, 404, 412
EcoT22I ATGCAT 1 cut(s) 90
EcoT38I GRGCYC 3 cut(s) 368, 757, 879
ErhI CCWWGG 3 cut(s) 307, 404, 412
FaeI CATG 9 cut(s) 64, 92, 239, 347, 392, 542, 862, 1006, 1138
FalI AAGNNNNNCTT 2 cut(s) 112, 144
FaqI GGGAC 1 cut(s) 749
FatI CATG 9 cut(s) 60, 88, 235, 343, 388, 538, 858, 1002, 1134
FauI CCCGC 2 cut(s) 389, 764
FbaI TGATCA 1 cut(s) 450
FblI GTMKAC 1 cut(s) 1090
Fnu4HI GCNGC 2 cut(s) 140, 986
FokI GGATG 4 cut(s) 710, 917, 948, 960
FriOI GRGCYC 3 cut(s) 368, 757, 879
Fsp4HI GCNGC 2 cut(s) 140, 986
FspBI CTAG 5 cut(s) 216, 308, 405, 843, 896
GluI GCNGC 2 cut(s) 140, 986
HaeIII GGCC 5 cut(s) 175, 731, 755, 888, 985
HapII CCGG 3 cut(s) 728, 733, 751
Hin1II CATG 9 cut(s) 64, 92, 239, 347, 392, 542, 862, 1006, 1138
HincII GTYRAC 1 cut(s) 211
HindII GTYRAC 1 cut(s) 211
HpaII CCGG 3 cut(s) 728, 733, 751
HphI GGTGA 4 cut(s) 546, 617, 647, 843
Hpy166II GTNNAC 2 cut(s) 211, 1091
Hpy188I TCNGA 3 cut(s) 231, 450, 502
Hpy188III TCNNGA 3 cut(s) 369, 539, 830
Hpy8I GTNNAC 2 cut(s) 211, 1091
HpyCH4III ACNGT 3 cut(s) 769, 811, 1088
HpyCH4IV ACGT 3 cut(s) 179, 186, 455
HpyCH4V TGCA 5 cut(s) 88, 319, 429, 481, 961
HpyF10VI GCNNNNNNNGC 3 cut(s) 94, 189, 874
HpyF3I CTNAG 4 cut(s) 108, 163, 616, 638
HpySE526I ACGT 3 cut(s) 179, 186, 455
Hsp92II CATG 9 cut(s) 64, 92, 239, 347, 392, 542, 862, 1006, 1138
Ksp22I TGATCA 1 cut(s) 450
Kzo9I GATC 7 cut(s) 312, 399, 408, 423, 450, 740, 924
LmnI GCTCC 2 cut(s) 764, 882
LweI GCATC 2 cut(s) 970, 1005
MaeI CTAG 5 cut(s) 216, 308, 405, 843, 896
MaeII ACGT 3 cut(s) 179, 186, 455
MaeIII GTNAC 7 cut(s) 166, 623, 719, 849, 950, 1079, 1142
MalI GATC 7 cut(s) 314, 401, 410, 425, 452, 742, 926
MbiI CCGCTC 1 cut(s) 759
MboI GATC 7 cut(s) 312, 399, 408, 423, 450, 740, 924
MboII GAAGA 1 cut(s) 238
MflI RGATCY 4 cut(s) 312, 399, 408, 423
MhlI GDGCHC 4 cut(s) 368, 757, 879, 1051
MmeI TCCRAC 1 cut(s) 290
MnlI CCTC 6 cut(s) 212, 218, 679, 815, 899, 1062
Mph1103I ATGCAT 1 cut(s) 90
MroXI GAANNNNTTC 1 cut(s) 550
MseI TTAA 8 cut(s) 9, 71, 78, 285, 351, 569, 1026, 1065
MslI CAYNNNNRTG 1 cut(s) 1001
MspI CCGG 3 cut(s) 728, 733, 751
MspR9I CCNGG 7 cut(s) 728, 733, 734, 751, 752, 935, 1008
MvaI CCWGG 2 cut(s) 935, 1008
MwoI GCNNNNNNNGC 3 cut(s) 94, 189, 874
NciI CCSGG 5 cut(s) 728, 733, 734, 751, 752
NdeII GATC 7 cut(s) 312, 399, 408, 423, 450, 740, 924
NlaIII CATG 9 cut(s) 64, 92, 239, 347, 392, 542, 862, 1006, 1138
NlaIV GGNNCC 4 cut(s) 314, 401, 410, 755
NmeAIII GCCGAG 1 cut(s) 151
NmuCI GTSAC 6 cut(s) 623, 719, 849, 950, 1079, 1142
NsiI ATGCAT 1 cut(s) 90
NspI RCATGY 2 cut(s) 92, 1006
PagI TCATGA 1 cut(s) 538
PasI CCCWGGG 1 cut(s) 934
PceI AGGCCT 1 cut(s) 888
PdmI GAANNNNTTC 1 cut(s) 550
PkrI GCNGC 2 cut(s) 141, 987
PmaCI CACGTG 1 cut(s) 456
PmlI CACGTG 1 cut(s) 456
Ppu21I YACGTR 3 cut(s) 180, 187, 456
PshBI ATTAAT 1 cut(s) 1026
PsiI TTATAA 1 cut(s) 609
Psp124BI GAGCTC 2 cut(s) 368, 879
Psp6I CCWGG 2 cut(s) 933, 1006
PspCI CACGTG 1 cut(s) 456
PspEI GGTNACC 1 cut(s) 849
PspGI CCWGG 2 cut(s) 933, 1006
PspN4I GGNNCC 4 cut(s) 314, 401, 410, 755
PspOMI GGGCCC 1 cut(s) 753
PspPI GGNCC 4 cut(s) 730, 753, 754, 983
PsuI RGATCY 4 cut(s) 312, 399, 408, 423
RsaI GTAC 4 cut(s) 328, 339, 376, 463
RsaNI GTAC 4 cut(s) 327, 338, 375, 462
RseI CAYNNNNRTG 1 cut(s) 1001
SacI GAGCTC 2 cut(s) 368, 879
SaqAI TTAA 8 cut(s) 9, 71, 78, 285, 351, 569, 1026, 1065
SatI GCNGC 2 cut(s) 140, 986
Sau3AI GATC 7 cut(s) 312, 399, 408, 423, 450, 740, 924
Sau96I GGNCC 4 cut(s) 730, 753, 754, 983
ScrFI CCNGG 7 cut(s) 728, 733, 734, 751, 752, 935, 1008
SduI GDGCHC 4 cut(s) 368, 757, 879, 1051
SfaNI GCATC 2 cut(s) 970, 1005
SfcI CTRYAG 1 cut(s) 1087
SmaI CCCGGG 2 cut(s) 734, 752
SmiMI CAYNNNNRTG 1 cut(s) 1001
SmlI CTYRAG 1 cut(s) 1053
SmoI CTYRAG 1 cut(s) 1053
SseBI AGGCCT 1 cut(s) 888
SsiI CCGC 5 cut(s) 140, 396, 757, 785, 986
SspMI CTAG 5 cut(s) 216, 308, 405, 843, 896
SstI GAGCTC 2 cut(s) 368, 879
StuI AGGCCT 1 cut(s) 888
StyD4I CCNGG 7 cut(s) 726, 731, 732, 749, 750, 933, 1006
StyI CCWWGG 3 cut(s) 307, 404, 412
TaaI ACNGT 3 cut(s) 769, 811, 1088
TaiI ACGT 3 cut(s) 182, 189, 458
TaqI TCGA 1 cut(s) 743
TaqII GACCGA 1 cut(s) 558
TauI GCSGC 2 cut(s) 142, 988
Tru1I TTAA 8 cut(s) 9, 71, 78, 285, 351, 569, 1026, 1065
Tru9I TTAA 8 cut(s) 9, 71, 78, 285, 351, 569, 1026, 1065
TscAI CASTG 1 cut(s) 1111
TseFI GTSAC 6 cut(s) 623, 719, 849, 950, 1079, 1142
Tsp45I GTSAC 6 cut(s) 623, 719, 849, 950, 1079, 1142
TspDTI ATGAA 6 cut(s) 32, 49, 303, 395, 527, 1044
TspGWI ACGGA 1 cut(s) 753
TspMI CCCGGG 2 cut(s) 732, 750
TspRI CASTG 1 cut(s) 1111
VspI ATTAAT 1 cut(s) 1026
XapI RAATTY 4 cut(s) 28, 38, 45, 1099
XceI RCATGY 2 cut(s) 92, 1006
XmaI CCCGGG 2 cut(s) 732, 750
XmaJI CCTAGG 2 cut(s) 307, 404
XmiI GTMKAC 1 cut(s) 1090
XmnI GAANNNNTTC 1 cut(s) 550
XspI CTAG 5 cut(s) 216, 308, 405, 843, 896
Zsp2I ATGCAT 1 cut(s) 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.