pycom17g16460

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
Physical Location & Seq
Forward (+)
14573617 .. 14574137
521 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom17g16460.2

Sequence Viewer

Length: 387 bp
ATGGAGCCAAACTGTAACATCCCACATCAACCAACAGAAAGGGGGAGACCTTTTGGAAACCCACTGGCTTTAGATTCCATCGGAACTCCGAAGTTAAGCGAGTTTGGGCGAGATTTCCCGAAACAAAACCGTGAGGGCATGGCTGGGGCCCAAAGCGGACAATATCGTGCTACGGCGGAGCCGAGACTGGGATGTGACATAATGGTATCAGAGCCACTCTGTCGTGTGGTGCGACCCACATCGACCAACAGAGAAGGGGTGATGTGCCTTATATGTACATGCCCACCTCCATATAGCACAAGGCCTTTTGGGTACTCATTGACTTCGGATTCCATTGGAACTCCAAAGTTAAGCAAGTTCGGGCGAGAGCATTCCCAGGATGAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

129

Amino Acids

14.07

Weight (kDa)

7.6

Isoelectric Point (pI)

44.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 156, 176
AfaI GTAC 2 cut(s) 277, 314
AfiI CCNNNNNNNGG 1 cut(s) 188
AjnI CCWGG 1 cut(s) 375
Alw26I GTCTC 2 cut(s) 40, 178
AoxI GGCC 2 cut(s) 147, 302
ApaI GGGCCC 1 cut(s) 151
AspS9I GGNCC 2 cut(s) 147, 148
AsuHPI GGTGA 1 cut(s) 271
BaeGI GKGCMC 1 cut(s) 151
BanII GRGCYC 1 cut(s) 151
BccI CCATC 1 cut(s) 86
BceAI ACGGC 1 cut(s) 189
BciT130I CCWGG 1 cut(s) 377
BcoDI GTCTC 2 cut(s) 40, 178
Bme1390I CCNGG 1 cut(s) 377
BmgT120I GGNCC 2 cut(s) 147, 148
BmiI GGNNCC 4 cut(s) 6, 148, 149, 180
BmrFI CCNGG 1 cut(s) 377
BmrI ACTGGG 1 cut(s) 197
BmuI ACTGGG 1 cut(s) 197
BsaI GGTCTC 1 cut(s) 40
BsaJI CCNNGG 1 cut(s) 375
Bsc4I CCNNNNNNNGG 1 cut(s) 188
Bse1I ACTGG 2 cut(s) 69, 192
BseBI CCWGG 1 cut(s) 377
BseDI CCNNGG 1 cut(s) 375
BseGI GGATG 3 cut(s) 18, 197, 385
BseLI CCNNNNNNNGG 1 cut(s) 188
BseNI ACTGG 2 cut(s) 69, 192
BseSI GKGCMC 1 cut(s) 151
BseYI CCCAGC 1 cut(s) 143
BshFI GGCC 2 cut(s) 149, 304
BslI CCNNNNNNNGG 1 cut(s) 188
BsmAI GTCTC 2 cut(s) 40, 178
BsmI GAATGC 1 cut(s) 370
BsnI GGCC 2 cut(s) 149, 304
Bso31I GGTCTC 1 cut(s) 40
Bsp120I GGGCCC 1 cut(s) 147
Bsp1286I GDGCHC 1 cut(s) 151
Bsp1407I TGTACA 1 cut(s) 275
BspACI CCGC 2 cut(s) 156, 176
BspANI GGCC 2 cut(s) 149, 304
BspLI GGNNCC 4 cut(s) 6, 148, 149, 180
BspTNI GGTCTC 1 cut(s) 40
BsrGI TGTACA 1 cut(s) 275
BsrI ACTGG 2 cut(s) 69, 192
BssECI CCNNGG 1 cut(s) 375
Bst2UI CCWGG 1 cut(s) 377
Bst4CI ACNGT 2 cut(s) 14, 131
BstAUI TGTACA 1 cut(s) 275
BstF5I GGATG 3 cut(s) 18, 197, 385
BstMAI GTCTC 2 cut(s) 40, 178
BstNI CCWGG 1 cut(s) 377
BstNSI RCATGY 1 cut(s) 282
BstSCI CCNGG 1 cut(s) 375
BstSLI GKGCMC 1 cut(s) 151
BsuRI GGCC 2 cut(s) 149, 304
BtsCI GGATG 3 cut(s) 18, 197, 385
BtsIMutI CAGTG 1 cut(s) 62
Cfr13I GGNCC 2 cut(s) 147, 148
Csp6I GTAC 2 cut(s) 276, 313
CviAII CATG 2 cut(s) 139, 279
CviJI RGCY 7 cut(s) 7, 68, 143, 149, 181, 214, 304
CviKI_1 RGCY 7 cut(s) 7, 68, 143, 149, 181, 214, 304
CviQI GTAC 2 cut(s) 276, 313
EciI GGCGGA 1 cut(s) 191
Eco147I AGGCCT 1 cut(s) 304
Eco24I GRGCYC 1 cut(s) 151
Eco31I GGTCTC 1 cut(s) 40
EcoO109I RGGNCCY 1 cut(s) 147
EcoRII CCWGG 1 cut(s) 375
EcoT38I GRGCYC 1 cut(s) 151
FaeI CATG 2 cut(s) 142, 282
FaiI YATR 7 cut(s) 140, 200, 272, 274, 280, 292, 294
FatI CATG 2 cut(s) 138, 278
FokI GGATG 2 cut(s) 5, 204
FriOI GRGCYC 1 cut(s) 151
GsaI CCCAGC 1 cut(s) 147
HaeIII GGCC 2 cut(s) 149, 304
Hin1II CATG 2 cut(s) 142, 282
HinfI GANTC 2 cut(s) 74, 329
HphI GGTGA 1 cut(s) 271
Hpy188I TCNGA 4 cut(s) 83, 90, 211, 328
Hpy188III TCNNGA 1 cut(s) 118
HpyAV CCTTC 1 cut(s) 248
HpyCH4III ACNGT 2 cut(s) 14, 131
Hsp92II CATG 2 cut(s) 142, 282
LmnI GCTCC 2 cut(s) 4, 178
LpnPI CCDG 4 cut(s) 50, 129, 173, 362
MaeIII GTNAC 2 cut(s) 14, 194
MhlI GDGCHC 1 cut(s) 151
MnlI CCTC 2 cut(s) 127, 297
MseI TTAA 2 cut(s) 95, 350
MspR9I CCNGG 1 cut(s) 377
Mva1269I GAATGC 1 cut(s) 370
MvaI CCWGG 1 cut(s) 377
NlaIII CATG 2 cut(s) 142, 282
NlaIV GGNNCC 4 cut(s) 6, 148, 149, 180
NmeAIII GCCGAG 1 cut(s) 207
NmuCI GTSAC 1 cut(s) 194
NspI RCATGY 1 cut(s) 282
PceI AGGCCT 1 cut(s) 304
PcsI WCGNNNNNNNCGW 2 cut(s) 179, 229
PctI GAATGC 1 cut(s) 370
PfeI GAWTC 2 cut(s) 74, 329
Psp6I CCWGG 1 cut(s) 375
PspFI CCCAGC 1 cut(s) 143
PspGI CCWGG 1 cut(s) 375
PspN4I GGNNCC 4 cut(s) 6, 148, 149, 180
PspOMI GGGCCC 1 cut(s) 147
PspPI GGNCC 2 cut(s) 147, 148
RsaI GTAC 2 cut(s) 277, 314
RsaNI GTAC 2 cut(s) 276, 313
SaqAI TTAA 2 cut(s) 95, 350
Sau96I GGNCC 2 cut(s) 147, 148
ScrFI CCNGG 1 cut(s) 377
SduI GDGCHC 1 cut(s) 151
SetI ASST 2 cut(s) 52, 289
SseBI AGGCCT 1 cut(s) 304
SsiI CCGC 2 cut(s) 156, 176
StuI AGGCCT 1 cut(s) 304
StyD4I CCNGG 1 cut(s) 375
TaaI ACNGT 2 cut(s) 14, 131
TaqI TCGA 1 cut(s) 242
TatI WGTACW 1 cut(s) 275
TfiI GAWTC 2 cut(s) 74, 329
Tru1I TTAA 2 cut(s) 95, 350
Tru9I TTAA 2 cut(s) 95, 350
TscAI CASTG 1 cut(s) 69
TseFI GTSAC 1 cut(s) 194
Tsp45I GTSAC 1 cut(s) 194
TspRI CASTG 1 cut(s) 69
XceI RCATGY 1 cut(s) 282
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.