pycom01g02770

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
OG0000158
Physical Location & Seq
Forward (+)
2277266 .. 2278285
1020 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g02770.3

Sequence Viewer

Length: 711 bp
ATGGGAGTGGATCCTGCCTTTTGGGAGCTCATTGGCTTCGGTTTCCATCGGAACTCCGAAGTTAAGCAAGTTTTGGGCAAGAGCATTCCCAGGAAGGGTGACCAACTGGGAAGTTCTTGTGTGAGTTCCCAGAAACAAAACCGTGAGGTCGTAGTCGGGGCCCAAAGTGGACAATATCTTGCTACGGTGGAGTCGAGCCCGGGATGTGGTGGAGGCCTGAGACGGGATGTAACAATTTGGTATCAGAGACAATCCCTGGCCGGAAGTGTGCCGACGAGGACGTCGGGAGTGGATCCTGTAAGCCTTATATGTATATTCCTATCTCTACCTGGCACGAGGCCTTTTGGGAGCTCACTGGGCGAGAGCTTTCCCAGGATGGGTAACCCACTGGGAAGTTCCCGTGTGAGTTCCCAGAAACAAAATCGTGAGGGCGTGGTCGGGGCCCAAAGCAGACAATATCGTGCTACGGTGGAGTCAAGCTCGGGATATTTTCCTAATTTCATTGAATTGGACTCAGCGACACAATCAAATTATTCTTATCAAGTTCCGTATATGAATAGCATTTGTAACTATGAACTGCATGATACTCCTGCCAGGAATTTACTGAACACAGTTATGACTAGTGAAATTCCCTTATATTCTAGCATCAAATCCCTGCATTTCTCTATAAATCAAATAAGTAAATCACATTCATGTTTTATGAAACAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

237

Amino Acids

25.82

Weight (kDa)

9.14

Isoelectric Point (pI)

49.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 280
AatII GACGTC 1 cut(s) 284
AclWI GGATC 4 cut(s) 5, 18, 287, 300
AcoI YGGCCR 1 cut(s) 258
AcsI RAATTY 2 cut(s) 598, 627
AcyI GRCGYC 1 cut(s) 281
AfiI CCNNNNNNNGG 4 cut(s) 95, 206, 223, 377
AgsI TTSAA 1 cut(s) 506
AhlI ACTAGT 1 cut(s) 620
AjnI CCWGG 5 cut(s) 89, 255, 328, 371, 593
AluBI AGCT 4 cut(s) 28, 351, 366, 480
AluI AGCT 4 cut(s) 28, 351, 366, 480
Alw21I GWGCWC 2 cut(s) 30, 353
Alw26I GTCTC 2 cut(s) 214, 241
AlwI GGATC 4 cut(s) 5, 18, 287, 300
Ama87I CYCGRG 2 cut(s) 199, 481
AoxI GGCC 5 cut(s) 159, 214, 258, 338, 441
ApaI GGGCCC 2 cut(s) 163, 445
ApoI RAATTY 2 cut(s) 598, 627
AspS9I GGNCC 4 cut(s) 159, 160, 441, 442
AsuC2I CCSGG 2 cut(s) 200, 201
AsuHPI GGTGA 1 cut(s) 110
AvaI CYCGRG 2 cut(s) 199, 481
BaeGI GKGCMC 2 cut(s) 163, 445
BamHI GGATCC 2 cut(s) 10, 292
BanII GRGCYC 5 cut(s) 30, 163, 200, 353, 445
BauI CACGAG 1 cut(s) 334
Bbv12I GWGCWC 2 cut(s) 30, 353
BccI CCATC 2 cut(s) 54, 370
BciT130I CCWGG 5 cut(s) 91, 257, 330, 373, 595
BcnI CCSGG 2 cut(s) 200, 201
BcoDI GTCTC 2 cut(s) 214, 241
BcuI ACTAGT 1 cut(s) 620
BfaI CTAG 2 cut(s) 621, 642
Bme1390I CCNGG 7 cut(s) 91, 200, 201, 257, 330, 373, 595
BmeT110I CYCGRG 2 cut(s) 199, 481
BmgT120I GGNCC 4 cut(s) 159, 160, 441, 442
BmiI GGNNCC 6 cut(s) 12, 160, 161, 294, 442, 443
BmrFI CCNGG 7 cut(s) 91, 200, 201, 257, 330, 373, 595
BmrI ACTGGG 3 cut(s) 116, 365, 398
BmsI GCATC 1 cut(s) 654
BmuI ACTGGG 3 cut(s) 116, 365, 398
BplI GAGNNNNNCTC 2 cut(s) 464, 496
BpuMI CCSGG 2 cut(s) 200, 201
BsaHI GRCGYC 1 cut(s) 281
BsaJI CCNNGG 4 cut(s) 89, 199, 255, 371
Bsc4I CCNNNNNNNGG 4 cut(s) 95, 206, 223, 377
Bse1I ACTGG 3 cut(s) 111, 360, 393
BseBI CCWGG 5 cut(s) 91, 257, 330, 373, 595
BseDI CCNNGG 4 cut(s) 89, 199, 255, 371
BseGI GGATG 3 cut(s) 209, 232, 381
BseLI CCNNNNNNNGG 4 cut(s) 95, 206, 223, 377
BseMII CTCAG 2 cut(s) 209, 528
BseNI ACTGG 3 cut(s) 111, 360, 393
BseSI GKGCMC 2 cut(s) 163, 445
BshFI GGCC 5 cut(s) 161, 216, 260, 340, 443
BsiHKAI GWGCWC 2 cut(s) 30, 353
BsiHKCI CYCGRG 2 cut(s) 199, 481
BsiSI CCGG 2 cut(s) 200, 261
BslI CCNNNNNNNGG 4 cut(s) 95, 206, 223, 377
BsmAI GTCTC 2 cut(s) 214, 241
BsmBI CGTCTC 1 cut(s) 214
BsmI GAATGC 1 cut(s) 84
BsnI GGCC 5 cut(s) 161, 216, 260, 340, 443
BsoBI CYCGRG 2 cut(s) 199, 481
Bsp120I GGGCCC 2 cut(s) 159, 441
Bsp1286I GDGCHC 5 cut(s) 30, 163, 200, 353, 445
Bsp143I GATC 2 cut(s) 10, 292
BspANI GGCC 5 cut(s) 161, 216, 260, 340, 443
BspCNI CTCAG 2 cut(s) 210, 527
BspLI GGNNCC 6 cut(s) 12, 160, 161, 294, 442, 443
BspPI GGATC 4 cut(s) 5, 18, 287, 300
BsrI ACTGG 3 cut(s) 111, 360, 393
BssECI CCNNGG 4 cut(s) 89, 199, 255, 371
BssMI GATC 2 cut(s) 10, 292
BssNI GRCGYC 1 cut(s) 281
BssSI CACGAG 1 cut(s) 334
Bst2BI CACGAG 1 cut(s) 334
Bst2UI CCWGG 5 cut(s) 91, 257, 330, 373, 595
Bst4CI ACNGT 4 cut(s) 143, 187, 469, 613
BstACI GRCGYC 1 cut(s) 281
BstDEI CTNAG 2 cut(s) 218, 514
BstEII GGTNACC 2 cut(s) 98, 380
BstF5I GGATG 3 cut(s) 209, 232, 381
BstKTI GATC 2 cut(s) 13, 295
BstMAI GTCTC 2 cut(s) 214, 241
BstMBI GATC 2 cut(s) 10, 292
BstMWI GCNNNNNNNGC 1 cut(s) 357
BstNI CCWGG 5 cut(s) 91, 257, 330, 373, 595
BstPI GGTNACC 2 cut(s) 98, 380
BstSCI CCNGG 7 cut(s) 89, 198, 199, 255, 328, 371, 593
BstSLI GKGCMC 2 cut(s) 163, 445
BstX2I RGATCY 2 cut(s) 10, 292
BstYI RGATCY 2 cut(s) 10, 292
BsuRI GGCC 5 cut(s) 161, 216, 260, 340, 443
BtsCI GGATG 3 cut(s) 209, 232, 381
BtsIMutI CAGTG 2 cut(s) 353, 386
Cfr13I GGNCC 4 cut(s) 159, 160, 441, 442
Cfr9I CCCGGG 1 cut(s) 199
CviAII CATG 2 cut(s) 581, 693
DdeI CTNAG 2 cut(s) 218, 514
DpnI GATC 2 cut(s) 12, 294
DpnII GATC 2 cut(s) 10, 292
DrdI GACNNNNNNGTC 1 cut(s) 280
DseDI GACNNNNNNGTC 1 cut(s) 280
EaeI YGGCCR 1 cut(s) 258
Ecl136II GAGCTC 2 cut(s) 28, 351
Eco147I AGGCCT 2 cut(s) 216, 340
Eco24I GRGCYC 5 cut(s) 30, 163, 200, 353, 445
Eco53kI GAGCTC 2 cut(s) 28, 351
Eco88I CYCGRG 2 cut(s) 199, 481
Eco91I GGTNACC 2 cut(s) 98, 380
EcoICRI GAGCTC 2 cut(s) 28, 351
EcoO109I RGGNCCY 2 cut(s) 159, 441
EcoO65I GGTNACC 2 cut(s) 98, 380
EcoRII CCWGG 5 cut(s) 89, 255, 328, 371, 593
EcoT38I GRGCYC 5 cut(s) 30, 163, 200, 353, 445
Esp3I CGTCTC 1 cut(s) 214
FaeI CATG 2 cut(s) 584, 696
FatI CATG 2 cut(s) 580, 692
FokI GGATG 3 cut(s) 216, 239, 388
FriOI GRGCYC 5 cut(s) 30, 163, 200, 353, 445
FspBI CTAG 2 cut(s) 621, 642
HaeIII GGCC 5 cut(s) 161, 216, 260, 340, 443
HapII CCGG 2 cut(s) 200, 261
Hin1I GRCGYC 1 cut(s) 281
Hin1II CATG 2 cut(s) 584, 696
HinfI GANTC 3 cut(s) 191, 473, 512
HpaII CCGG 2 cut(s) 200, 261
HphI GGTGA 1 cut(s) 110
Hpy166II GTNNAC 1 cut(s) 170
Hpy188I TCNGA 3 cut(s) 51, 58, 246
Hpy188III TCNNGA 3 cut(s) 285, 425, 483
Hpy8I GTNNAC 1 cut(s) 170
Hpy99I CGWCG 2 cut(s) 277, 286
HpyAV CCTTC 1 cut(s) 88
HpyCH4III ACNGT 4 cut(s) 143, 187, 469, 613
HpyCH4IV ACGT 1 cut(s) 281
HpyCH4V TGCA 2 cut(s) 580, 658
HpyF10VI GCNNNNNNNGC 1 cut(s) 357
HpyF3I CTNAG 2 cut(s) 218, 514
HpySE526I ACGT 1 cut(s) 281
Hsp92I GRCGYC 1 cut(s) 281
Hsp92II CATG 2 cut(s) 584, 696
Kzo9I GATC 2 cut(s) 10, 292
LmnI GCTCC 2 cut(s) 25, 348
LweI GCATC 1 cut(s) 654
MaeI CTAG 2 cut(s) 621, 642
MaeII ACGT 1 cut(s) 281
MaeIII GTNAC 4 cut(s) 98, 229, 380, 566
MalI GATC 2 cut(s) 12, 294
MboI GATC 2 cut(s) 10, 292
MflI RGATCY 2 cut(s) 10, 292
MhlI GDGCHC 5 cut(s) 30, 163, 200, 353, 445
MluCI AATT 6 cut(s) 234, 496, 506, 529, 598, 627
MlyI GAGTC 3 cut(s) 200, 482, 506
MnlI CCTC 5 cut(s) 139, 206, 270, 330, 421
MseI TTAA 1 cut(s) 63
MslI CAYNNNNRTG 2 cut(s) 614, 691
MspI CCGG 2 cut(s) 200, 261
MspR9I CCNGG 7 cut(s) 91, 200, 201, 257, 330, 373, 595
Mva1269I GAATGC 1 cut(s) 84
MvaI CCWGG 5 cut(s) 91, 257, 330, 373, 595
MwoI GCNNNNNNNGC 1 cut(s) 357
NciI CCSGG 2 cut(s) 200, 201
NdeII GATC 2 cut(s) 10, 292
NlaIII CATG 2 cut(s) 584, 696
NlaIV GGNNCC 6 cut(s) 12, 160, 161, 294, 442, 443
NmuCI GTSAC 1 cut(s) 98
PceI AGGCCT 2 cut(s) 216, 340
PcsI WCGNNNNNNNCGW 1 cut(s) 191
PctI GAATGC 1 cut(s) 84
PleI GAGTC 3 cut(s) 199, 481, 506
PpsI GAGTC 3 cut(s) 199, 481, 506
Psp124BI GAGCTC 2 cut(s) 30, 353
Psp6I CCWGG 5 cut(s) 89, 255, 328, 371, 593
PspEI GGTNACC 2 cut(s) 98, 380
PspGI CCWGG 5 cut(s) 89, 255, 328, 371, 593
PspN4I GGNNCC 6 cut(s) 12, 160, 161, 294, 442, 443
PspOMI GGGCCC 2 cut(s) 159, 441
PspPI GGNCC 4 cut(s) 159, 160, 441, 442
PsuI RGATCY 2 cut(s) 10, 292
RseI CAYNNNNRTG 2 cut(s) 614, 691
SacI GAGCTC 2 cut(s) 30, 353
SaqAI TTAA 1 cut(s) 63
Sau3AI GATC 2 cut(s) 10, 292
Sau96I GGNCC 4 cut(s) 159, 160, 441, 442
SchI GAGTC 3 cut(s) 200, 482, 506
ScrFI CCNGG 7 cut(s) 91, 200, 201, 257, 330, 373, 595
SduI GDGCHC 5 cut(s) 30, 163, 200, 353, 445
SetI ASST 7 cut(s) 30, 150, 284, 331, 353, 368, 482
SfaNI GCATC 1 cut(s) 654
SmaI CCCGGG 1 cut(s) 201
SmiMI CAYNNNNRTG 2 cut(s) 614, 691
SpeI ACTAGT 1 cut(s) 620
Sse9I AATT 6 cut(s) 234, 496, 506, 529, 598, 627
SseBI AGGCCT 2 cut(s) 216, 340
SspMI CTAG 2 cut(s) 621, 642
SstI GAGCTC 2 cut(s) 30, 353
StuI AGGCCT 2 cut(s) 216, 340
StyD4I CCNGG 7 cut(s) 89, 198, 199, 255, 328, 371, 593
TaaI ACNGT 4 cut(s) 143, 187, 469, 613
TaiI ACGT 1 cut(s) 284
TaqI TCGA 1 cut(s) 194
TasI AATT 6 cut(s) 234, 496, 506, 529, 598, 627
Tru1I TTAA 1 cut(s) 63
Tru9I TTAA 1 cut(s) 63
TscAI CASTG 2 cut(s) 360, 393
TseFI GTSAC 1 cut(s) 98
Tsp45I GTSAC 1 cut(s) 98
TspDTI ATGAA 4 cut(s) 490, 569, 588, 681
TspGWI ACGGA 1 cut(s) 537
TspMI CCCGGG 1 cut(s) 199
TspRI CASTG 2 cut(s) 360, 393
XapI RAATTY 2 cut(s) 598, 627
XmaI CCCGGG 1 cut(s) 199
XspI CTAG 2 cut(s) 621, 642
ZraI GACGTC 1 cut(s) 282
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.