pycom13g25800

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
Physical Location & Seq
Forward (+)
22532667 .. 22533492
826 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom13g25800.4

Sequence Viewer

Length: 675 bp
ATGTTGCATTGGAAATCCCTGAGGCAATTGTTGGAAGGTTTAGATTGTGTTTTGTTTGTTTTGTTTATTTCGTTTTGCTTGAGGACTAGCAAAAGTTGCTTCCTTGCATTTAGTGAGTTAATTACTACTTATTATAGTCTTTTAAGCTATTTTCGTATGTTTGTAGGTCCTAATAGCAAAAGGAGCAAGAAAGTGCATTTTGAAGCTATTTGGAGCAGTTTTGGCCATGGATTGGATAGTTTAACTATGGAGCAAAGTGGATGGACGAAATTGAAGTCAAGAGAGGCTAGGAGAGGCTACAAATCTGGAGAAAGAAGTTCAAATGCAAAGAAGATTGATAGGAGCATATTTAGGCGACTTATTTTGTGTGTTTTTAGGTTCATATGGCTAAGGAAGCAAAAAGGTCTTGGAGCAAAAGGAATGGACGAAATTGAAGACTTAAAGATGTTAGGATTCCTAATCAAAGTAGGATTCCTAATCAAAGAAGGATTCCTAATCAAAGAAGGATTCCTAATCAAAGTAGGATTCCTAATCAAAGAAGGATTCCTAATCAAAGAAGGATTCCTAATCAAAGTAGGATTCCTAATCAAAGAAGGATTCCTAGTCAAAGAAGGATTCCTAATCAAAGTAGGAAAGTTAAGCCAAGGTTTCCTATTTTGGTTTAACCTTTCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

225

Amino Acids

25.95

Weight (kDa)

9.99

Isoelectric Point (pI)

30.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 232
AcoI YGGCCR 1 cut(s) 223
AfiI CCNNNNNNNGG 1 cut(s) 232
AgsI TTSAA 4 cut(s) 203, 274, 321, 434
AluBI AGCT 2 cut(s) 147, 206
AluI AGCT 2 cut(s) 147, 206
AoxI GGCC 1 cut(s) 223
ArsI GACNNNNNNTTYG 2 cut(s) 260, 292
AspS9I GGNCC 1 cut(s) 167
AvaII GGWCC 1 cut(s) 167
AxyI CCTNAGG 1 cut(s) 20
BalI TGGCCA 1 cut(s) 225
BbsI GAAGAC 1 cut(s) 441
BccI CCATC 1 cut(s) 255
BfaI CTAG 3 cut(s) 87, 288, 602
Bme18I GGWCC 1 cut(s) 167
BmgT120I GGNCC 1 cut(s) 167
BpiI GAAGAC 1 cut(s) 441
BpmI CTGGAG 1 cut(s) 327
Bpu10I CCTNAGC 1 cut(s) 389
BpuEI CTTGAG 1 cut(s) 100
BsaJI CCNNGG 2 cut(s) 226, 643
Bsc4I CCNNNNNNNGG 1 cut(s) 232
Bse21I CCTNAGG 1 cut(s) 20
BseDI CCNNGG 2 cut(s) 226, 643
BseGI GGATG 1 cut(s) 266
BseLI CCNNNNNNNGG 1 cut(s) 232
BseMII CTCAG 1 cut(s) 11
BshFI GGCC 1 cut(s) 225
BslI CCNNNNNNNGG 1 cut(s) 232
BsnI GGCC 1 cut(s) 225
Bsp19I CCATGG 1 cut(s) 226
BspANI GGCC 1 cut(s) 225
BspCNI CTCAG 1 cut(s) 12
BssECI CCNNGG 2 cut(s) 226, 643
BssT1I CCWWGG 2 cut(s) 226, 643
BstAPI GCANNNNNTGC 1 cut(s) 96
BstDEI CTNAG 2 cut(s) 20, 389
BstDSI CCRYGG 1 cut(s) 226
BstF5I GGATG 1 cut(s) 266
BstMWI GCNNNNNNNGC 4 cut(s) 96, 183, 222, 394
BstV2I GAAGAC 1 cut(s) 441
Bsu36I CCTNAGG 1 cut(s) 20
BsuRI GGCC 1 cut(s) 225
BtgI CCRYGG 1 cut(s) 226
BtsCI GGATG 1 cut(s) 266
Cfr13I GGNCC 1 cut(s) 167
CviAII CATG 1 cut(s) 227
CviJI RGCY 7 cut(s) 147, 206, 225, 287, 297, 388, 642
CviKI_1 RGCY 7 cut(s) 147, 206, 225, 287, 297, 388, 642
DdeI CTNAG 2 cut(s) 20, 389
EaeI YGGCCR 1 cut(s) 223
Eco130I CCWWGG 2 cut(s) 226, 643
Eco47I GGWCC 1 cut(s) 167
Eco81I CCTNAGG 1 cut(s) 20
EcoO109I RGGNCCY 1 cut(s) 167
EcoT14I CCWWGG 2 cut(s) 226, 643
ErhI CCWWGG 2 cut(s) 226, 643
FaeI CATG 1 cut(s) 230
FaiI YATR 7 cut(s) 135, 158, 228, 248, 347, 383, 385
FatI CATG 1 cut(s) 226
FauNDI CATATG 1 cut(s) 383
FokI GGATG 1 cut(s) 273
FspBI CTAG 3 cut(s) 87, 288, 602
GsuI CTGGAG 1 cut(s) 327
HaeIII GGCC 1 cut(s) 225
Hin1II CATG 1 cut(s) 230
Hpy188III TCNNGA 2 cut(s) 279, 306
HpyAV CCTTC 7 cut(s) 29, 479, 497, 533, 551, 587, 605
HpyCH4V TGCA 4 cut(s) 7, 107, 196, 326
HpyF10VI GCNNNNNNNGC 4 cut(s) 96, 183, 222, 394
HpyF3I CTNAG 2 cut(s) 20, 389
Hsp92II CATG 1 cut(s) 230
LmnI GCTCC 5 cut(s) 183, 213, 250, 342, 410
LpnPI CCDG 2 cut(s) 32, 291
MaeI CTAG 3 cut(s) 87, 288, 602
MboII GAAGA 2 cut(s) 343, 446
MfeI CAATTG 1 cut(s) 26
MlsI TGGCCA 1 cut(s) 225
MluCI AATT 4 cut(s) 26, 120, 269, 429
MluNI TGGCCA 1 cut(s) 225
MmeI TCCRAC 1 cut(s) 12
MnlI CCTC 4 cut(s) 15, 75, 277, 287
Mox20I TGGCCA 1 cut(s) 225
MscI TGGCCA 1 cut(s) 225
MseI TTAA 6 cut(s) 119, 143, 242, 440, 638, 663
Msp20I TGGCCA 1 cut(s) 225
MunI CAATTG 1 cut(s) 26
MwoI GCNNNNNNNGC 4 cut(s) 96, 183, 222, 394
NcoI CCATGG 1 cut(s) 226
NdeI CATATG 1 cut(s) 383
NlaIII CATG 1 cut(s) 230
PflMI CCANNNNNTGG 1 cut(s) 232
PpuMI RGGWCCY 1 cut(s) 167
Psp5II RGGWCCY 1 cut(s) 167
PspPI GGNCC 1 cut(s) 167
PspPPI RGGWCCY 1 cut(s) 167
SaqAI TTAA 6 cut(s) 119, 143, 242, 440, 638, 663
Sau96I GGNCC 1 cut(s) 167
SetI ASST 8 cut(s) 40, 149, 169, 208, 380, 406, 649, 669
SinI GGWCC 1 cut(s) 167
SmlI CTYRAG 1 cut(s) 79
SmoI CTYRAG 1 cut(s) 79
Sse9I AATT 4 cut(s) 26, 120, 269, 429
SspMI CTAG 3 cut(s) 87, 288, 602
StyI CCWWGG 2 cut(s) 226, 643
TasI AATT 4 cut(s) 26, 120, 269, 429
Tru1I TTAA 6 cut(s) 119, 143, 242, 440, 638, 663
Tru9I TTAA 6 cut(s) 119, 143, 242, 440, 638, 663
TspDTI ATGAA 1 cut(s) 370
Van91I CCANNNNNTGG 1 cut(s) 232
VpaK11BI GGWCC 1 cut(s) 167
XspI CTAG 3 cut(s) 87, 288, 602
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.