pycom10g28250

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr10
OG0000158
Physical Location & Seq
Forward (+)
28919109 .. 28920275
1167 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom10g28250.2

Sequence Viewer

Length: 930 bp
ATGTTATTTGGAATTTTTCCACTTGCCACCTCCATTAATCTTCTTCAACTTTCTTTTTTCTTTTTCCTCTTATGTTTAAGGGTGTACTATCCACACCTTCTGTTAATTTTTAAAAAAGGATGTGTAGATATCACACTCTTATGTTTATTCTACAATGCCAGTAAATATAAGGAAAGCAATTGTAAGGTTCATTGTCACATCCCCCACAATATTGTCTGTTTTGGGCCCCTACCACGCCCTCACGGTTTTGTTTCTGGGAACTCACACGAGAACTTCCCAGTGGGTCACCCATCCTGGGATTGCTCTGGCGCGAACTCGCTTAACTTCAGAGTTCCGACAAAACCTGAAGCTAGTGAGCTCCCAAAAGGCCTTATGCTAGGTAGAGATGAGAATATACATATAAGGCTTACAAGATCCACTCCTCTGGACGATGTGGGATGTTACAATCCACCCCCCTTAGGGGCCCGACATCCTCGTCGGCATATTTCCGGGGCAAGGATTGGCTCTGATAGTAAATTGTCACATCCAAGCTCGGTGTCCGCTTTGGGCCCCTACCATACCCTCACGGTTTTGTTTCTGCAAACTCACACGAGAACTTCCCTAGTAGGTCACCCATCCTGGGATTGCTCTCGCTCGAACTCGCTTAACTTCGGAGTTCCGACGGAACCCGAAGCTAATGAGCTCCCAAAAGACATCGTGCTAGGTAGAGATGGGAATATACATATAAGGTTTACAGGATCCACTCCCCTGATCAATGTGGGATGTTACATTCATGTTTGTATAAGGCTTGTGTTTTCGAAGTTCCATTGCCTATATTGGAGGTATGATGAGTTTGGGAATTTTGGTCGGCGAGTGGATTTAATTAAATCTATTATATTTCGTGTAAATAAGTGTTTGTTTATACTTAAAATATATATGATTTCATCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

310

Amino Acids

34.89

Weight (kDa)

9.19

Isoelectric Point (pI)

44.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 474
AccII CGCG 1 cut(s) 311
AciI CCGC 1 cut(s) 540
AclWI GGATC 3 cut(s) 408, 732, 745
AcsI RAATTY 2 cut(s) 12, 838
AcuI CTGAAG 2 cut(s) 310, 366
AfaI GTAC 1 cut(s) 86
AfiI CCNNNNNNNGG 6 cut(s) 295, 458, 459, 460, 495, 619
AgsI TTSAA 1 cut(s) 47
AjnI CCWGG 2 cut(s) 293, 617
AluBI AGCT 5 cut(s) 350, 358, 531, 674, 682
AluI AGCT 5 cut(s) 350, 358, 531, 674, 682
Alw21I GWGCWC 2 cut(s) 360, 684
AlwI GGATC 3 cut(s) 408, 732, 745
AoxI GGCC 4 cut(s) 224, 367, 462, 547
ApaI GGGCCC 3 cut(s) 228, 466, 551
ApoI RAATTY 2 cut(s) 12, 838
AseI ATTAAT 1 cut(s) 36
AspLEI GCGC 1 cut(s) 311
AspS9I GGNCC 6 cut(s) 224, 225, 462, 463, 547, 548
AsuC2I CCSGG 1 cut(s) 490
AsuHPI GGTGA 2 cut(s) 278, 602
AsuII TTCGAA 1 cut(s) 797
AxyI CCTNAGG 1 cut(s) 457
BaeGI GKGCMC 3 cut(s) 228, 466, 551
BamHI GGATCC 1 cut(s) 737
BanII GRGCYC 5 cut(s) 228, 360, 466, 551, 684
BauI CACGAG 2 cut(s) 266, 589
Bbv12I GWGCWC 2 cut(s) 360, 684
BccI CCATC 3 cut(s) 298, 622, 704
BciT130I CCWGG 2 cut(s) 295, 619
BclI TGATCA 1 cut(s) 750
BcnI CCSGG 1 cut(s) 490
BfaI CTAG 4 cut(s) 351, 377, 602, 701
Bme1390I CCNGG 3 cut(s) 295, 490, 619
BmgT120I GGNCC 6 cut(s) 224, 225, 462, 463, 547, 548
BmiI GGNNCC 8 cut(s) 226, 227, 463, 464, 549, 550, 666, 739
BmrFI CCNGG 3 cut(s) 295, 490, 619
BmrI ACTGGG 1 cut(s) 272
BmuI ACTGGG 1 cut(s) 272
Bpu14I TTCGAA 1 cut(s) 797
BpuMI CCSGG 1 cut(s) 490
BsaJI CCNNGG 3 cut(s) 294, 489, 618
Bsc4I CCNNNNNNNGG 6 cut(s) 295, 458, 459, 460, 495, 619
Bse1I ACTGG 2 cut(s) 159, 278
Bse21I CCTNAGG 1 cut(s) 457
Bse3DI GCAATG 1 cut(s) 805
BseBI CCWGG 2 cut(s) 295, 619
BseDI CCNNGG 3 cut(s) 294, 489, 618
BseGI GGATG 8 cut(s) 125, 198, 290, 443, 469, 523, 614, 767
BseLI CCNNNNNNNGG 6 cut(s) 295, 458, 459, 460, 495, 619
BseMI GCAATG 1 cut(s) 805
BseNI ACTGG 2 cut(s) 159, 278
BseRI GAGGAG 1 cut(s) 411
BseSI GKGCMC 3 cut(s) 228, 466, 551
Bsh1236I CGCG 1 cut(s) 311
BshFI GGCC 4 cut(s) 226, 369, 464, 549
BsiHKAI GWGCWC 2 cut(s) 360, 684
BsiSI CCGG 1 cut(s) 489
BslI CCNNNNNNNGG 6 cut(s) 295, 458, 459, 460, 495, 619
BsnI GGCC 4 cut(s) 226, 369, 464, 549
Bsp119I TTCGAA 1 cut(s) 797
Bsp120I GGGCCC 3 cut(s) 224, 462, 547
Bsp1286I GDGCHC 5 cut(s) 228, 360, 466, 551, 684
Bsp143I GATC 3 cut(s) 413, 737, 750
BspACI CCGC 1 cut(s) 540
BspANI GGCC 4 cut(s) 226, 369, 464, 549
BspFNI CGCG 1 cut(s) 311
BspLI GGNNCC 8 cut(s) 226, 227, 463, 464, 549, 550, 666, 739
BspPI GGATC 3 cut(s) 408, 732, 745
BspT104I TTCGAA 1 cut(s) 797
BsrDI GCAATG 1 cut(s) 805
BsrI ACTGG 2 cut(s) 159, 278
BssECI CCNNGG 3 cut(s) 294, 489, 618
BssMI GATC 3 cut(s) 413, 737, 750
BssSI CACGAG 2 cut(s) 266, 589
Bst2BI CACGAG 2 cut(s) 266, 589
Bst2UI CCWGG 2 cut(s) 295, 619
Bst4CI ACNGT 2 cut(s) 245, 568
BstBI TTCGAA 1 cut(s) 797
BstDEI CTNAG 1 cut(s) 457
BstEII GGTNACC 2 cut(s) 284, 608
BstF5I GGATG 8 cut(s) 125, 198, 290, 443, 469, 523, 614, 767
BstFNI CGCG 1 cut(s) 311
BstHHI GCGC 1 cut(s) 311
BstKTI GATC 3 cut(s) 416, 740, 753
BstMBI GATC 3 cut(s) 413, 737, 750
BstNI CCWGG 2 cut(s) 295, 619
BstPI GGTNACC 2 cut(s) 284, 608
BstSCI CCNGG 3 cut(s) 293, 488, 617
BstSLI GKGCMC 3 cut(s) 228, 466, 551
BstUI CGCG 1 cut(s) 311
BstX2I RGATCY 2 cut(s) 413, 737
BstXI CCANNNNNNTGG 1 cut(s) 424
BstYI RGATCY 2 cut(s) 413, 737
Bsu36I CCTNAGG 1 cut(s) 457
BsuRI GGCC 4 cut(s) 226, 369, 464, 549
BtsCI GGATG 8 cut(s) 125, 198, 290, 443, 469, 523, 614, 767
BtsIMutI CAGTG 1 cut(s) 285
CfoI GCGC 1 cut(s) 311
Cfr13I GGNCC 6 cut(s) 224, 225, 462, 463, 547, 548
Csp6I GTAC 1 cut(s) 85
CviAII CATG 1 cut(s) 773
CviQI GTAC 1 cut(s) 85
DdeI CTNAG 1 cut(s) 457
DpnI GATC 3 cut(s) 415, 739, 752
DpnII GATC 3 cut(s) 413, 737, 750
DraI TTTAAA 1 cut(s) 112
DrdI GACNNNNNNGTC 1 cut(s) 474
DseDI GACNNNNNNGTC 1 cut(s) 474
Ecl136II GAGCTC 2 cut(s) 358, 682
Eco147I AGGCCT 1 cut(s) 369
Eco24I GRGCYC 5 cut(s) 228, 360, 466, 551, 684
Eco32I GATATC 1 cut(s) 130
Eco53kI GAGCTC 2 cut(s) 358, 682
Eco57I CTGAAG 2 cut(s) 310, 366
Eco81I CCTNAGG 1 cut(s) 457
Eco91I GGTNACC 2 cut(s) 284, 608
EcoICRI GAGCTC 2 cut(s) 358, 682
EcoO109I RGGNCCY 3 cut(s) 225, 462, 548
EcoO65I GGTNACC 2 cut(s) 284, 608
EcoRII CCWGG 2 cut(s) 293, 617
EcoRV GATATC 1 cut(s) 130
EcoT38I GRGCYC 5 cut(s) 228, 360, 466, 551, 684
FaeI CATG 1 cut(s) 776
FatI CATG 1 cut(s) 772
FbaI TGATCA 1 cut(s) 750
FokI GGATG 8 cut(s) 132, 185, 277, 450, 456, 510, 601, 774
FriOI GRGCYC 5 cut(s) 228, 360, 466, 551, 684
FspBI CTAG 4 cut(s) 351, 377, 602, 701
GlaI GCGC 1 cut(s) 310
HaeIII GGCC 4 cut(s) 226, 369, 464, 549
HapII CCGG 1 cut(s) 489
HhaI GCGC 1 cut(s) 311
Hin1II CATG 1 cut(s) 776
Hin6I GCGC 1 cut(s) 309
HinP1I GCGC 1 cut(s) 309
HpaII CCGG 1 cut(s) 489
HphI GGTGA 2 cut(s) 278, 602
Hpy166II GTNNAC 2 cut(s) 85, 732
Hpy188I TCNGA 5 cut(s) 329, 336, 508, 653, 660
Hpy188III TCNNGA 1 cut(s) 425
Hpy8I GTNNAC 2 cut(s) 85, 732
Hpy99I CGWCG 2 cut(s) 480, 664
HpyAV CCTTC 1 cut(s) 107
HpyCH4III ACNGT 2 cut(s) 245, 568
HpyCH4V TGCA 1 cut(s) 580
HpyF3I CTNAG 1 cut(s) 457
Hsp92II CATG 1 cut(s) 776
HspAI GCGC 1 cut(s) 309
Ksp22I TGATCA 1 cut(s) 750
Kzo9I GATC 3 cut(s) 413, 737, 750
LmnI GCTCC 2 cut(s) 363, 687
MaeI CTAG 4 cut(s) 351, 377, 602, 701
MaeIII GTNAC 6 cut(s) 194, 284, 440, 519, 608, 764
MalI GATC 3 cut(s) 415, 739, 752
MboI GATC 3 cut(s) 413, 737, 750
MboII GAAGA 2 cut(s) 32, 35
MfeI CAATTG 1 cut(s) 178
MflI RGATCY 2 cut(s) 413, 737
MhlI GDGCHC 5 cut(s) 228, 360, 466, 551, 684
MluCI AATT 6 cut(s) 12, 105, 178, 515, 838, 861
MmeI TCCRAC 2 cut(s) 359, 683
MnlI CCTC 7 cut(s) 40, 77, 249, 432, 483, 572, 813
MseI TTAA 9 cut(s) 36, 77, 104, 111, 321, 645, 860, 864, 906
MslI CAYNNNNRTG 1 cut(s) 139
MspI CCGG 1 cut(s) 489
MspR9I CCNGG 3 cut(s) 295, 490, 619
MunI CAATTG 1 cut(s) 178
MvaI CCWGG 2 cut(s) 295, 619
MvnI CGCG 1 cut(s) 311
NciI CCSGG 1 cut(s) 490
NdeII GATC 3 cut(s) 413, 737, 750
NlaIII CATG 1 cut(s) 776
NlaIV GGNNCC 8 cut(s) 226, 227, 463, 464, 549, 550, 666, 739
NmuCI GTSAC 4 cut(s) 194, 284, 519, 608
NspV TTCGAA 1 cut(s) 797
PacI TTAATTAA 1 cut(s) 864
PceI AGGCCT 1 cut(s) 369
PshBI ATTAAT 1 cut(s) 36
Psp124BI GAGCTC 2 cut(s) 360, 684
Psp6I CCWGG 2 cut(s) 293, 617
PspEI GGTNACC 2 cut(s) 284, 608
PspGI CCWGG 2 cut(s) 293, 617
PspN4I GGNNCC 8 cut(s) 226, 227, 463, 464, 549, 550, 666, 739
PspOMI GGGCCC 3 cut(s) 224, 462, 547
PspPI GGNCC 6 cut(s) 224, 225, 462, 463, 547, 548
PsuI RGATCY 2 cut(s) 413, 737
RsaI GTAC 1 cut(s) 86
RsaNI GTAC 1 cut(s) 85
RseI CAYNNNNRTG 1 cut(s) 139
SacI GAGCTC 2 cut(s) 360, 684
SaqAI TTAA 9 cut(s) 36, 77, 104, 111, 321, 645, 860, 864, 906
Sau3AI GATC 3 cut(s) 413, 737, 750
Sau96I GGNCC 6 cut(s) 224, 225, 462, 463, 547, 548
ScrFI CCNGG 3 cut(s) 295, 490, 619
SduI GDGCHC 5 cut(s) 228, 360, 466, 551, 684
SfuI TTCGAA 1 cut(s) 797
SmiMI CAYNNNNRTG 1 cut(s) 139
Sse9I AATT 6 cut(s) 12, 105, 178, 515, 838, 861
SseBI AGGCCT 1 cut(s) 369
SsiI CCGC 1 cut(s) 540
SspI AATATT 1 cut(s) 211
SspMI CTAG 4 cut(s) 351, 377, 602, 701
SstI GAGCTC 2 cut(s) 360, 684
StuI AGGCCT 1 cut(s) 369
StyD4I CCNGG 3 cut(s) 293, 488, 617
TaaI ACNGT 2 cut(s) 245, 568
TaqI TCGA 2 cut(s) 635, 797
TasI AATT 6 cut(s) 12, 105, 178, 515, 838, 861
TatI WGTACW 1 cut(s) 84
Tru1I TTAA 9 cut(s) 36, 77, 104, 111, 321, 645, 860, 864, 906
Tru9I TTAA 9 cut(s) 36, 77, 104, 111, 321, 645, 860, 864, 906
TscAI CASTG 1 cut(s) 285
TseFI GTSAC 4 cut(s) 194, 284, 519, 608
Tsp45I GTSAC 4 cut(s) 194, 284, 519, 608
TspDTI ATGAA 3 cut(s) 179, 761, 912
TspGWI ACGGA 1 cut(s) 677
TspRI CASTG 1 cut(s) 285
VspI ATTAAT 1 cut(s) 36
XapI RAATTY 2 cut(s) 12, 838
XspI CTAG 4 cut(s) 351, 377, 602, 701
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.