pycom11g23650

leucine-rich repeat receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
Physical Location & Seq
Forward (+)
26635039 .. 26636363
1325 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom11g23650.6

Sequence Viewer

Length: 759 bp
ATGCACTCAGAGTTGGCAAACTCAAATTTTCAAACCTTTACGAAGAAGTTCCTAAGAACATATACTATATTCTTTACTGAGTTTTATGTATTCATTATTTTTAGATTCTTAACTGGAAACTTGCTGACTGGACCCGTACCTACCTGGCCGAAAGACGTCATTGATCTTTCATATAACAACCTCACCATAGGGGATGGAGGTTGTCTACCACCAGGCAGCATGAACTTATTTGCAAGCTCGTCAAAGGACAATAGTTTGAGAATTGTTTCATGTTTCAGAACTGCACAATGTCCACCATATTTGTACTACTCTCTCCGTATAAATTGTGGTGGGGAAGAATTTACTGTCCCTGGAGAGACAAATACATCATATGATGTTGACACAGATTCAGCTGGACCTTCATCATTTTACCAGAGCACAACAAATTGGGCATTAAGCAACACTGGTTACTTCACTGATGATGACCAAACTACGGACACCCTTATAGCTAATAATAAAGCTAGACTCTATATGGAGCATATTCATGCGACTGAAATGGCTTGTTCTCGTGCATTTACGTTATGTTTCTCTCGTTATTTTAGTCCTTTATGCTTCTTTTGTGTGTTTTCAGGTTCTAAGGGCCTAGGGAGCAAGAAAGTGCATTTTGAGGCCATTTGGAGCATTTTTGGGCATGATTTGGATAGCTTAATCATGGAGCAAAGAGGATGGACGAAATTGAAGCCTTGTATGCTCTTTGGGGACATCAAACAAAGGGCCTAG

Protein Analysis

253

Amino Acids

28.5

Weight (kDa)

6.2

Isoelectric Point (pI)

37.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 159
AccI GTMKAC 1 cut(s) 205
AcoI YGGCCR 1 cut(s) 146
AcsI RAATTY 2 cut(s) 25, 338
AcyI GRCGYC 1 cut(s) 156
AfaI GTAC 2 cut(s) 138, 305
AfiI CCNNNNNNNGG 1 cut(s) 472
AgsI TTSAA 2 cut(s) 32, 718
AjnI CCWGG 3 cut(s) 143, 211, 349
AluBI AGCT 5 cut(s) 237, 392, 488, 500, 684
AluI AGCT 5 cut(s) 237, 392, 488, 500, 684
Alw21I GWGCWC 1 cut(s) 419
Alw26I GTCTC 1 cut(s) 350
AoxI GGCC 4 cut(s) 146, 619, 648, 753
ApeKI GCWGC 1 cut(s) 216
ApoI RAATTY 2 cut(s) 25, 338
Asp700I GAANNNNTTC 2 cut(s) 47, 265
AspA2I CCTAGG 1 cut(s) 622
AspS9I GGNCC 4 cut(s) 131, 395, 619, 753
AsuHPI GGTGA 1 cut(s) 175
AvaII GGWCC 2 cut(s) 131, 395
AvrII CCTAGG 1 cut(s) 622
BauI CACGAG 1 cut(s) 546
Bbv12I GWGCWC 1 cut(s) 419
BbvI GCAGC 1 cut(s) 228
BccI CCATC 2 cut(s) 188, 699
BciT130I CCWGG 3 cut(s) 145, 213, 351
BcoDI GTCTC 1 cut(s) 350
BfaI CTAG 3 cut(s) 501, 623, 757
BisI GCNGC 1 cut(s) 217
BlnI CCTAGG 1 cut(s) 622
BlsI GCNGC 1 cut(s) 218
Bme1390I CCNGG 3 cut(s) 145, 213, 351
Bme18I GGWCC 2 cut(s) 131, 395
BmgT120I GGNCC 4 cut(s) 131, 395, 619, 753
BmiI GGNNCC 1 cut(s) 133
BmrFI CCNGG 3 cut(s) 145, 213, 351
BpmI CTGGAG 1 cut(s) 372
BsaHI GRCGYC 1 cut(s) 156
BsaJI CCNNGG 2 cut(s) 349, 622
Bsc4I CCNNNNNNNGG 1 cut(s) 472
Bse1I ACTGG 3 cut(s) 118, 133, 448
BseBI CCWGG 3 cut(s) 145, 213, 351
BseDI CCNNGG 2 cut(s) 349, 622
BseGI GGATG 2 cut(s) 199, 710
BseLI CCNNNNNNNGG 1 cut(s) 472
BseMII CTCAG 2 cut(s) 21, 69
BseNI ACTGG 3 cut(s) 118, 133, 448
BseXI GCAGC 1 cut(s) 228
BsgI GTGCAG 1 cut(s) 267
BshFI GGCC 4 cut(s) 148, 621, 650, 755
BsiHKAI GWGCWC 1 cut(s) 419
BslFI GGGAC 2 cut(s) 332, 752
BslI CCNNNNNNNGG 1 cut(s) 472
BsmAI GTCTC 1 cut(s) 350
BsmFI GGGAC 2 cut(s) 332, 752
BsnI GGCC 4 cut(s) 148, 621, 650, 755
Bsp1286I GDGCHC 1 cut(s) 419
Bsp143I GATC 1 cut(s) 163
BspANI GGCC 4 cut(s) 148, 621, 650, 755
BspCNI CTCAG 2 cut(s) 20, 70
BspLI GGNNCC 1 cut(s) 133
BsrI ACTGG 3 cut(s) 118, 133, 448
BssECI CCNNGG 2 cut(s) 349, 622
BssMI GATC 1 cut(s) 163
BssNI GRCGYC 1 cut(s) 156
BssSI CACGAG 1 cut(s) 546
BssT1I CCWWGG 1 cut(s) 622
Bst2BI CACGAG 1 cut(s) 546
Bst2UI CCWGG 3 cut(s) 145, 213, 351
Bst4CI ACNGT 1 cut(s) 346
BstACI GRCGYC 1 cut(s) 156
BstC8I GCNNGC 1 cut(s) 235
BstDEI CTNAG 4 cut(s) 7, 53, 78, 615
BstF5I GGATG 2 cut(s) 199, 710
BstKTI GATC 1 cut(s) 166
BstMAI GTCTC 1 cut(s) 350
BstMBI GATC 1 cut(s) 163
BstMWI GCNNNNNNNGC 2 cut(s) 627, 727
BstNI CCWGG 3 cut(s) 145, 213, 351
BstSCI CCNGG 3 cut(s) 143, 211, 349
BstV1I GCAGC 1 cut(s) 228
BsuRI GGCC 4 cut(s) 148, 621, 650, 755
BtsCI GGATG 2 cut(s) 199, 710
BtsIMutI CAGTG 2 cut(s) 441, 453
Cac8I GCNNGC 1 cut(s) 235
Cfr13I GGNCC 4 cut(s) 131, 395, 619, 753
Csp6I GTAC 2 cut(s) 137, 304
CspCI CAANNNNNGTGG 2 cut(s) 282, 317
CviAII CATG 5 cut(s) 220, 270, 524, 671, 691
CviQI GTAC 2 cut(s) 137, 304
DdeI CTNAG 4 cut(s) 7, 53, 78, 615
DpnI GATC 1 cut(s) 165
DpnII GATC 1 cut(s) 163
EaeI YGGCCR 1 cut(s) 146
Eco130I CCWWGG 1 cut(s) 622
Eco47I GGWCC 2 cut(s) 131, 395
EcoO109I RGGNCCY 2 cut(s) 619, 753
EcoRII CCWGG 3 cut(s) 143, 211, 349
EcoT14I CCWWGG 1 cut(s) 622
ErhI CCWWGG 1 cut(s) 622
FaeI CATG 5 cut(s) 223, 273, 527, 674, 694
FaqI GGGAC 2 cut(s) 332, 752
FatI CATG 5 cut(s) 219, 269, 523, 670, 690
FauNDI CATATG 1 cut(s) 370
FblI GTMKAC 1 cut(s) 205
Fnu4HI GCNGC 1 cut(s) 217
FokI GGATG 2 cut(s) 206, 717
Fsp4HI GCNGC 1 cut(s) 217
FspBI CTAG 3 cut(s) 501, 623, 757
GluI GCNGC 1 cut(s) 217
GsuI CTGGAG 1 cut(s) 372
HaeIII GGCC 4 cut(s) 148, 621, 650, 755
Hin1I GRCGYC 1 cut(s) 156
Hin1II CATG 5 cut(s) 223, 273, 527, 674, 694
HincII GTYRAC 1 cut(s) 379
HindII GTYRAC 1 cut(s) 379
HinfI GANTC 3 cut(s) 105, 386, 504
HphI GGTGA 1 cut(s) 175
Hpy166II GTNNAC 3 cut(s) 206, 293, 379
Hpy188I TCNGA 2 cut(s) 10, 278
Hpy8I GTNNAC 3 cut(s) 206, 293, 379
HpyAV CCTTC 1 cut(s) 408
HpyCH4III ACNGT 1 cut(s) 346
HpyCH4IV ACGT 2 cut(s) 156, 557
HpyCH4V TGCA 5 cut(s) 4, 233, 284, 551, 640
HpyF10VI GCNNNNNNNGC 2 cut(s) 627, 727
HpyF3I CTNAG 4 cut(s) 7, 53, 78, 615
HpySE526I ACGT 2 cut(s) 156, 557
Hsp92I GRCGYC 1 cut(s) 156
Hsp92II CATG 5 cut(s) 223, 273, 527, 674, 694
Kzo9I GATC 1 cut(s) 163
LmnI GCTCC 4 cut(s) 514, 627, 657, 694
Lsp1109I GCAGC 1 cut(s) 228
MaeI CTAG 3 cut(s) 501, 623, 757
MaeII ACGT 2 cut(s) 156, 557
MaeIII GTNAC 1 cut(s) 446
MalI GATC 1 cut(s) 165
MboI GATC 1 cut(s) 163
MboII GAAGA 2 cut(s) 55, 347
MhlI GDGCHC 1 cut(s) 419
MluCI AATT 6 cut(s) 25, 261, 322, 338, 424, 713
MlyI GAGTC 1 cut(s) 498
MnlI CCTC 4 cut(s) 191, 191, 640, 695
MroXI GAANNNNTTC 2 cut(s) 47, 265
MseI TTAA 3 cut(s) 110, 434, 686
MslI CAYNNNNRTG 1 cut(s) 522
MspA1I CMGCKG 1 cut(s) 392
MspR9I CCNGG 3 cut(s) 145, 213, 351
MvaI CCWGG 3 cut(s) 145, 213, 351
MwoI GCNNNNNNNGC 2 cut(s) 627, 727
NdeI CATATG 1 cut(s) 370
NdeII GATC 1 cut(s) 163
NlaIII CATG 5 cut(s) 223, 273, 527, 674, 694
NlaIV GGNNCC 1 cut(s) 133
PdmI GAANNNNTTC 2 cut(s) 47, 265
PfeI GAWTC 2 cut(s) 105, 386
PkrI GCNGC 1 cut(s) 218
PleI GAGTC 1 cut(s) 498
PpsI GAGTC 1 cut(s) 498
Psp6I CCWGG 3 cut(s) 143, 211, 349
PspGI CCWGG 3 cut(s) 143, 211, 349
PspN4I GGNNCC 1 cut(s) 133
PspPI GGNCC 4 cut(s) 131, 395, 619, 753
PvuII CAGCTG 1 cut(s) 392
RsaI GTAC 2 cut(s) 138, 305
RsaNI GTAC 2 cut(s) 137, 304
RseI CAYNNNNRTG 1 cut(s) 522
SaqAI TTAA 3 cut(s) 110, 434, 686
SatI GCNGC 1 cut(s) 217
Sau3AI GATC 1 cut(s) 163
Sau96I GGNCC 4 cut(s) 131, 395, 619, 753
SchI GAGTC 1 cut(s) 498
ScrFI CCNGG 3 cut(s) 145, 213, 351
SduI GDGCHC 1 cut(s) 419
SinI GGWCC 2 cut(s) 131, 395
SmiMI CAYNNNNRTG 1 cut(s) 522
Sse9I AATT 6 cut(s) 25, 261, 322, 338, 424, 713
SspMI CTAG 3 cut(s) 501, 623, 757
StyD4I CCNGG 3 cut(s) 143, 211, 349
StyI CCWWGG 1 cut(s) 622
TaaI ACNGT 1 cut(s) 346
TaiI ACGT 2 cut(s) 159, 560
TasI AATT 6 cut(s) 25, 261, 322, 338, 424, 713
TatI WGTACW 1 cut(s) 303
TfiI GAWTC 2 cut(s) 105, 386
Tru1I TTAA 3 cut(s) 110, 434, 686
Tru9I TTAA 3 cut(s) 110, 434, 686
TscAI CASTG 2 cut(s) 448, 460
TseI GCWGC 1 cut(s) 216
TspDTI ATGAA 6 cut(s) 82, 159, 236, 258, 390, 512
TspGWI ACGGA 2 cut(s) 305, 488
TspRI CASTG 2 cut(s) 448, 460
VpaK11BI GGWCC 2 cut(s) 131, 395
XapI RAATTY 2 cut(s) 25, 338
XmaJI CCTAGG 1 cut(s) 622
XmiI GTMKAC 1 cut(s) 205
XmnI GAANNNNTTC 2 cut(s) 47, 265
XspI CTAG 3 cut(s) 501, 623, 757
ZraI GACGTC 1 cut(s) 157
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.