MD13G1192400.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr13
OG0000158
Physical Location & Seq
Forward (+)
16559166 .. 16561217
2052 bp
Loading structure...
UTR
Exon/CDS
Intron
MD13G1192400.v1.1.491

Sequence Viewer

Length: 378 bp
ATGATAATTTGGTGTTCAAATAATTTAGTATTCGGAACCGTAAACCGGCAAGAACTGAATCGAAACCGGTGTAGACTGAACCGTATGGTTCTAGTAATAAATTTAAGCGGAACTGCACCGAACCGCACCGTGCCCACCCCTACTCTTCCCCATCCCCAGCCGCATTCACCCAAATTCCTCCATTGCCAAATTCCTTTCCTTTCTCCATTGTACTTCGCCACTTTTCTCCATTGCCAAATTGCTCTCCTCTTTAATCTCATCATCCCCATCATCAAAATCCAAAATAAATTGGCTCTAATTATCAAACAATTCAAGAGGAACATCGACGAAAAAATGGTCGCACTGTTCCTACCTACCATACCCGCACCGCGACCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

126

Amino Acids

14.37

Weight (kDa)

10.66

Isoelectric Point (pI)

42.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 73
AccII CGCG 1 cut(s) 370
AciI CCGC 5 cut(s) 108, 124, 161, 363, 368
AcsI RAATTY 3 cut(s) 100, 173, 189
AfaI GTAC 1 cut(s) 212
AfiI CCNNNNNNNGG 1 cut(s) 45
AgeI ACCGGT 1 cut(s) 66
AgsI TTSAA 2 cut(s) 18, 313
ApoI RAATTY 3 cut(s) 100, 173, 189
ArsI GACNNNNNNTTYG 2 cut(s) 321, 353
AsiGI ACCGGT 1 cut(s) 66
AsuHPI GGTGA 1 cut(s) 159
BaeGI GKGCMC 1 cut(s) 135
BccI CCATC 2 cut(s) 159, 275
BfaI CTAG 1 cut(s) 92
BisI GCNGC 1 cut(s) 161
BlsI GCNGC 1 cut(s) 162
BmiI GGNNCC 1 cut(s) 37
BsaWI WCCGGW 1 cut(s) 66
Bsc4I CCNNNNNNNGG 1 cut(s) 45
Bse118I RCCGGY 2 cut(s) 45, 66
Bse3DI GCAATG 2 cut(s) 181, 229
BseGI GGATG 2 cut(s) 151, 261
BseLI CCNNNNNNNGG 1 cut(s) 45
BseMI GCAATG 2 cut(s) 181, 229
BseRI GAGGAG 1 cut(s) 236
BseSI GKGCMC 1 cut(s) 135
BseYI CCCAGC 1 cut(s) 156
BsgI GTGCAG 1 cut(s) 99
Bsh1236I CGCG 1 cut(s) 370
BshTI ACCGGT 1 cut(s) 66
BsiSI CCGG 2 cut(s) 46, 67
BslI CCNNNNNNNGG 1 cut(s) 45
BsmI GAATGC 1 cut(s) 163
Bsp1286I GDGCHC 1 cut(s) 135
BspACI CCGC 5 cut(s) 108, 124, 161, 363, 368
BspFNI CGCG 1 cut(s) 370
BspLI GGNNCC 1 cut(s) 37
BsrDI GCAATG 2 cut(s) 181, 229
BsrFI RCCGGY 2 cut(s) 45, 66
BssAI RCCGGY 2 cut(s) 45, 66
Bst4CI ACNGT 4 cut(s) 40, 83, 130, 345
Bst6I CTCTTC 1 cut(s) 150
BstF5I GGATG 2 cut(s) 151, 261
BstFNI CGCG 1 cut(s) 370
BstSLI GKGCMC 1 cut(s) 135
BstUI CGCG 1 cut(s) 370
BtsCI GGATG 2 cut(s) 151, 261
BtsIMutI CAGTG 1 cut(s) 341
Cfr10I RCCGGY 2 cut(s) 45, 66
Csp6I GTAC 1 cut(s) 211
CspAI ACCGGT 1 cut(s) 66
CviAII CATG 1 cut(s) 375
CviJI RGCY 2 cut(s) 160, 293
CviKI_1 RGCY 2 cut(s) 160, 293
CviQI GTAC 1 cut(s) 211
Eam1104I CTCTTC 1 cut(s) 150
EarI CTCTTC 1 cut(s) 150
FaeI CATG 1 cut(s) 378
FaiI YATR 3 cut(s) 86, 359, 376
FatI CATG 1 cut(s) 374
FauI CCCGC 1 cut(s) 370
FblI GTMKAC 1 cut(s) 73
Fnu4HI GCNGC 1 cut(s) 161
FokI GGATG 2 cut(s) 138, 248
Fsp4HI GCNGC 1 cut(s) 161
FspBI CTAG 1 cut(s) 92
GluI GCNGC 1 cut(s) 161
GsaI CCCAGC 1 cut(s) 160
HapII CCGG 2 cut(s) 46, 67
Hin1II CATG 1 cut(s) 378
HinfI GANTC 1 cut(s) 58
HpaII CCGG 2 cut(s) 46, 67
HphI GGTGA 1 cut(s) 159
Hpy166II GTNNAC 2 cut(s) 43, 74
Hpy188I TCNGA 1 cut(s) 35
Hpy188III TCNNGA 1 cut(s) 313
Hpy8I GTNNAC 2 cut(s) 43, 74
Hpy99I CGWCG 1 cut(s) 329
HpyCH4III ACNGT 4 cut(s) 40, 83, 130, 345
HpyCH4V TGCA 1 cut(s) 116
Hsp92II CATG 1 cut(s) 378
LpnPI CCDG 3 cut(s) 59, 80, 170
MaeI CTAG 1 cut(s) 92
MboII GAAGA 1 cut(s) 137
MhlI GDGCHC 1 cut(s) 135
MluCI AATT 9 cut(s) 6, 22, 100, 173, 189, 237, 287, 297, 308
MnlI CCTC 3 cut(s) 188, 257, 309
MseI TTAA 2 cut(s) 104, 252
MspI CCGG 2 cut(s) 46, 67
Mva1269I GAATGC 1 cut(s) 163
MvnI CGCG 1 cut(s) 370
NlaIII CATG 1 cut(s) 378
NlaIV GGNNCC 1 cut(s) 37
PctI GAATGC 1 cut(s) 163
PfeI GAWTC 1 cut(s) 58
PinAI ACCGGT 1 cut(s) 66
PkrI GCNGC 1 cut(s) 162
PspFI CCCAGC 1 cut(s) 156
PspN4I GGNNCC 1 cut(s) 37
RsaI GTAC 1 cut(s) 212
RsaNI GTAC 1 cut(s) 211
SaqAI TTAA 2 cut(s) 104, 252
SatI GCNGC 1 cut(s) 161
SduI GDGCHC 1 cut(s) 135
SetI ASST 1 cut(s) 355
SgeI CNNG 8 cut(s) 58, 62, 79, 104, 142, 169, 325, 374
Sse9I AATT 9 cut(s) 6, 22, 100, 173, 189, 237, 287, 297, 308
SsiI CCGC 5 cut(s) 108, 124, 161, 363, 368
SspMI CTAG 1 cut(s) 92
TaaI ACNGT 4 cut(s) 40, 83, 130, 345
TaqI TCGA 2 cut(s) 61, 324
TasI AATT 9 cut(s) 6, 22, 100, 173, 189, 237, 287, 297, 308
TatI WGTACW 1 cut(s) 210
TauI GCSGC 1 cut(s) 163
TfiI GAWTC 1 cut(s) 58
Tru1I TTAA 2 cut(s) 104, 252
Tru9I TTAA 2 cut(s) 104, 252
TscAI CASTG 1 cut(s) 348
TspRI CASTG 1 cut(s) 348
XapI RAATTY 3 cut(s) 100, 173, 189
XmiI GTMKAC 1 cut(s) 73
XspI CTAG 1 cut(s) 92
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.