pycom12g09730

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
OG0000158
Physical Location & Seq
Forward (+)
11547182 .. 11547974
793 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12g09730.2

Sequence Viewer

Length: 666 bp
ATGAGAACAAGCCAATTAAGTCGCATAAATATGCTTCTATCACCTAGCACGATGCCTTTTGGGAGCTCACTGGCATCGGGTTCTGTACGAACTCTGAAGTTAAGCGAGAAAGGGGGCCAGAGCATTCCTAAGATGGGCGACCCATTGAGAAGTTCTGCTCGCGTGAGTTTCCAGAAACAAAACCGTGAGGGCGTGGTCAGGGCCCAAAGTGGACAATATCGTGCTACGGTAGAGTCAAGCCCGGGATTTCAATATTTTCAAATACTTTCAACCAATCTTTTATTATTATTCAAAATTAAAAATAAAATTATCTTTCAATTTAGAAATAAAAATACACTTAAGCAATTATTGTTCACTAAAAATAATTATCGTCCATTTGAAGGAATTAAATTGCCTCTAGCGTACGGAGTATTTAAGTGTGGAATTTGGTGGTATTCCCAAGGGGAATCCTGTTTCTCACCTCGATTGGACCGGTCACGACTCGTTTCGGACTGTTTTCGACTTGAGCTTTGTCTCGCTTGTTTTTCTCCGCGTTGCGGGCGCGCCTATTTGTACGCAGGTCGCGCGTACGGTCAAAACCTACGCTCGCCCTCCCACTCCAACCCCCAAACCCCCAAACCTTCCTCCTCCTTCCTCTCTTTCTATAGCTCAGCCATGTTTGTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

222

Amino Acids

24.98

Weight (kDa)

10.32

Isoelectric Point (pI)

54.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 548
AccII CGCG 5 cut(s) 162, 532, 543, 564, 566
AciI CCGC 2 cut(s) 530, 537
AcsI RAATTY 1 cut(s) 423
AcuI CTGAAG 1 cut(s) 116
AfaI GTAC 4 cut(s) 87, 404, 554, 569
AfiI CCNNNNNNNGG 3 cut(s) 134, 380, 536
AflII CTTAAG 1 cut(s) 338
AgeI ACCGGT 1 cut(s) 471
AgsI TTSAA 6 cut(s) 251, 260, 270, 292, 317, 380
AluBI AGCT 3 cut(s) 66, 508, 648
AluI AGCT 3 cut(s) 66, 508, 648
Alw21I GWGCWC 1 cut(s) 68
Alw26I GTCTC 1 cut(s) 518
Ama87I CYCGRG 1 cut(s) 241
AoxI GGCC 2 cut(s) 115, 201
ApaI GGGCCC 1 cut(s) 205
ApoI RAATTY 1 cut(s) 423
ArsI GACNNNNNNTTYG 2 cut(s) 492, 524
AscI GGCGCGCC 1 cut(s) 541
AsiGI ACCGGT 1 cut(s) 471
AspLEI GCGC 3 cut(s) 543, 545, 566
AspS9I GGNCC 4 cut(s) 115, 201, 202, 469
AsuC2I CCSGG 2 cut(s) 242, 243
AsuHPI GGTGA 2 cut(s) 33, 450
AvaI CYCGRG 1 cut(s) 241
AvaII GGWCC 1 cut(s) 469
BaeGI GKGCMC 1 cut(s) 205
BanII GRGCYC 2 cut(s) 68, 205
Bbv12I GWGCWC 1 cut(s) 68
BccI CCATC 1 cut(s) 127
BcnI CCSGG 2 cut(s) 242, 243
BcoDI GTCTC 1 cut(s) 518
BfaI CTAG 2 cut(s) 45, 398
BfmI CTRYAG 1 cut(s) 643
BfrI CTTAAG 1 cut(s) 338
BfuAI ACCTGC 1 cut(s) 548
BlpI GCTNAGC 1 cut(s) 649
Bme1390I CCNGG 2 cut(s) 242, 243
Bme18I GGWCC 1 cut(s) 469
BmeT110I CYCGRG 1 cut(s) 241
BmgT120I GGNCC 4 cut(s) 115, 201, 202, 469
BmiI GGNNCC 2 cut(s) 116, 203
BmrFI CCNGG 2 cut(s) 242, 243
BmsI GCATC 2 cut(s) 42, 83
Bpu1102I GCTNAGC 1 cut(s) 649
BpuEI CTTGAG 1 cut(s) 524
BpuMI CCSGG 2 cut(s) 242, 243
BsaJI CCNNGG 2 cut(s) 241, 439
BsaWI WCCGGW 1 cut(s) 471
Bsc4I CCNNNNNNNGG 3 cut(s) 134, 380, 536
Bse118I RCCGGY 1 cut(s) 471
Bse1I ACTGG 1 cut(s) 75
BseDI CCNNGG 2 cut(s) 241, 439
BseLI CCNNNNNNNGG 3 cut(s) 134, 380, 536
BseMII CTCAG 1 cut(s) 663
BseNI ACTGG 1 cut(s) 75
BsePI GCGCGC 1 cut(s) 541
BseRI GAGGAG 1 cut(s) 616
BseSI GKGCMC 1 cut(s) 205
Bsh1236I CGCG 5 cut(s) 162, 532, 543, 564, 566
BshFI GGCC 2 cut(s) 117, 203
BshTI ACCGGT 1 cut(s) 471
BsiHKAI GWGCWC 1 cut(s) 68
BsiHKCI CYCGRG 1 cut(s) 241
BsiSI CCGG 2 cut(s) 242, 472
BsiWI CGTACG 2 cut(s) 402, 567
BslI CCNNNNNNNGG 3 cut(s) 134, 380, 536
BsmAI GTCTC 1 cut(s) 518
BsmI GAATGC 1 cut(s) 123
BsnI GGCC 2 cut(s) 117, 203
BsoBI CYCGRG 1 cut(s) 241
Bsp120I GGGCCC 1 cut(s) 201
Bsp1286I GDGCHC 2 cut(s) 68, 205
Bsp1720I GCTNAGC 1 cut(s) 649
BspACI CCGC 2 cut(s) 530, 537
BspANI GGCC 2 cut(s) 117, 203
BspCNI CTCAG 1 cut(s) 662
BspFNI CGCG 5 cut(s) 162, 532, 543, 564, 566
BspLI GGNNCC 2 cut(s) 116, 203
BspMI ACCTGC 1 cut(s) 548
BspTI CTTAAG 1 cut(s) 338
BsrFI RCCGGY 1 cut(s) 471
BsrI ACTGG 1 cut(s) 75
BssAI RCCGGY 1 cut(s) 471
BssECI CCNNGG 2 cut(s) 241, 439
BssHII GCGCGC 1 cut(s) 541
BssT1I CCWWGG 1 cut(s) 439
Bst4CI ACNGT 4 cut(s) 185, 229, 494, 572
BstAFI CTTAAG 1 cut(s) 338
BstC8I GCNNGC 4 cut(s) 160, 539, 543, 587
BstDEI CTNAG 2 cut(s) 129, 649
BstFNI CGCG 5 cut(s) 162, 532, 543, 564, 566
BstHHI GCGC 3 cut(s) 543, 545, 566
BstMAI GTCTC 1 cut(s) 518
BstMWI GCNNNNNNNGC 2 cut(s) 538, 563
BstSCI CCNGG 2 cut(s) 240, 241
BstSFI CTRYAG 1 cut(s) 643
BstSLI GKGCMC 1 cut(s) 205
BstUI CGCG 5 cut(s) 162, 532, 543, 564, 566
BsuRI GGCC 2 cut(s) 117, 203
BtsIMutI CAGTG 1 cut(s) 68
BveI ACCTGC 1 cut(s) 548
Cac8I GCNNGC 4 cut(s) 160, 539, 543, 587
CfoI GCGC 3 cut(s) 543, 545, 566
Cfr10I RCCGGY 1 cut(s) 471
Cfr13I GGNCC 4 cut(s) 115, 201, 202, 469
Cfr9I CCCGGG 1 cut(s) 241
Csp6I GTAC 4 cut(s) 86, 403, 553, 568
CspAI ACCGGT 1 cut(s) 471
CviAII CATG 1 cut(s) 655
CviJI RGCY 8 cut(s) 12, 66, 117, 203, 240, 508, 648, 653
CviKI_1 RGCY 8 cut(s) 12, 66, 117, 203, 240, 508, 648, 653
CviQI GTAC 4 cut(s) 86, 403, 553, 568
DdeI CTNAG 2 cut(s) 129, 649
Ecl136II GAGCTC 1 cut(s) 66
Eco130I CCWWGG 1 cut(s) 439
Eco24I GRGCYC 2 cut(s) 68, 205
Eco47I GGWCC 1 cut(s) 469
Eco53kI GAGCTC 1 cut(s) 66
Eco57I CTGAAG 1 cut(s) 116
Eco88I CYCGRG 1 cut(s) 241
EcoICRI GAGCTC 1 cut(s) 66
EcoO109I RGGNCCY 1 cut(s) 201
EcoT14I CCWWGG 1 cut(s) 439
EcoT38I GRGCYC 2 cut(s) 68, 205
ErhI CCWWGG 1 cut(s) 439
FaeI CATG 1 cut(s) 658
FaiI YATR 4 cut(s) 26, 32, 645, 656
FatI CATG 1 cut(s) 654
FauI CCCGC 1 cut(s) 530
FriOI GRGCYC 2 cut(s) 68, 205
FspBI CTAG 2 cut(s) 45, 398
GlaI GCGC 3 cut(s) 542, 544, 565
HaeIII GGCC 2 cut(s) 117, 203
HapII CCGG 2 cut(s) 242, 472
HhaI GCGC 3 cut(s) 543, 545, 566
Hin1II CATG 1 cut(s) 658
Hin6I GCGC 3 cut(s) 541, 543, 564
HinP1I GCGC 3 cut(s) 541, 543, 564
HinfI GANTC 3 cut(s) 233, 446, 480
HpaII CCGG 2 cut(s) 242, 472
HphI GGTGA 2 cut(s) 33, 450
Hpy166II GTNNAC 2 cut(s) 212, 354
Hpy188I TCNGA 2 cut(s) 96, 490
Hpy188III TCNNGA 2 cut(s) 172, 477
Hpy8I GTNNAC 2 cut(s) 212, 354
HpyAV CCTTC 3 cut(s) 374, 630, 640
HpyCH4III ACNGT 4 cut(s) 185, 229, 494, 572
HpyF10VI GCNNNNNNNGC 2 cut(s) 538, 563
HpyF3I CTNAG 2 cut(s) 129, 649
Hsp92II CATG 1 cut(s) 658
HspAI GCGC 3 cut(s) 541, 543, 564
LmnI GCTCC 1 cut(s) 63
LpnPI CCDG 8 cut(s) 56, 131, 184, 185, 255, 463, 485, 543
LweI GCATC 2 cut(s) 42, 83
MaeI CTAG 2 cut(s) 45, 398
MaeIII GTNAC 1 cut(s) 474
MhlI GDGCHC 2 cut(s) 68, 205
MluCI AATT 9 cut(s) 14, 294, 306, 317, 344, 364, 384, 389, 423
MlyI GAGTC 2 cut(s) 242, 474
MmeI TCCRAC 1 cut(s) 624
MnlI CCTC 7 cut(s) 181, 405, 471, 601, 634, 637, 644
MseI TTAA 7 cut(s) 17, 101, 297, 339, 387, 414, 664
MslI CAYNNNNRTG 1 cut(s) 29
MspCI CTTAAG 1 cut(s) 338
MspI CCGG 2 cut(s) 242, 472
MspR9I CCNGG 2 cut(s) 242, 243
Mva1269I GAATGC 1 cut(s) 123
MvnI CGCG 5 cut(s) 162, 532, 543, 564, 566
MwoI GCNNNNNNNGC 2 cut(s) 538, 563
NciI CCSGG 2 cut(s) 242, 243
NlaIII CATG 1 cut(s) 658
NlaIV GGNNCC 2 cut(s) 116, 203
NmuCI GTSAC 1 cut(s) 474
PalAI GGCGCGCC 1 cut(s) 541
PauI GCGCGC 1 cut(s) 541
PctI GAATGC 1 cut(s) 123
PfeI GAWTC 1 cut(s) 446
Pfl23II CGTACG 2 cut(s) 402, 567
PinAI ACCGGT 1 cut(s) 471
PleI GAGTC 2 cut(s) 241, 474
PpsI GAGTC 2 cut(s) 241, 474
Psp124BI GAGCTC 1 cut(s) 68
PspLI CGTACG 2 cut(s) 402, 567
PspN4I GGNNCC 2 cut(s) 116, 203
PspOMI GGGCCC 1 cut(s) 201
PspPI GGNCC 4 cut(s) 115, 201, 202, 469
PteI GCGCGC 1 cut(s) 541
RsaI GTAC 4 cut(s) 87, 404, 554, 569
RsaNI GTAC 4 cut(s) 86, 403, 553, 568
RseI CAYNNNNRTG 1 cut(s) 29
SacI GAGCTC 1 cut(s) 68
SaqAI TTAA 7 cut(s) 17, 101, 297, 339, 387, 414, 664
Sau96I GGNCC 4 cut(s) 115, 201, 202, 469
SchI GAGTC 2 cut(s) 242, 474
ScrFI CCNGG 2 cut(s) 242, 243
SduI GDGCHC 2 cut(s) 68, 205
SetI ASST 8 cut(s) 46, 68, 463, 510, 562, 582, 622, 650
SfaNI GCATC 2 cut(s) 42, 83
SfcI CTRYAG 1 cut(s) 643
SgsI GGCGCGCC 1 cut(s) 541
SinI GGWCC 1 cut(s) 469
SmaI CCCGGG 1 cut(s) 243
SmiMI CAYNNNNRTG 1 cut(s) 29
SmlI CTYRAG 2 cut(s) 338, 503
SmoI CTYRAG 2 cut(s) 338, 503
Sse9I AATT 9 cut(s) 14, 294, 306, 317, 344, 364, 384, 389, 423
SsiI CCGC 2 cut(s) 530, 537
SspI AATATT 1 cut(s) 254
SspMI CTAG 2 cut(s) 45, 398
SstI GAGCTC 1 cut(s) 68
StyD4I CCNGG 2 cut(s) 240, 241
StyI CCWWGG 1 cut(s) 439
TaaI ACNGT 4 cut(s) 185, 229, 494, 572
TaqI TCGA 2 cut(s) 463, 499
TasI AATT 9 cut(s) 14, 294, 306, 317, 344, 364, 384, 389, 423
TfiI GAWTC 1 cut(s) 446
Tru1I TTAA 7 cut(s) 17, 101, 297, 339, 387, 414, 664
Tru9I TTAA 7 cut(s) 17, 101, 297, 339, 387, 414, 664
TscAI CASTG 1 cut(s) 75
TseFI GTSAC 1 cut(s) 474
Tsp45I GTSAC 1 cut(s) 474
TspGWI ACGGA 1 cut(s) 420
TspMI CCCGGG 1 cut(s) 241
TspRI CASTG 1 cut(s) 75
Vha464I CTTAAG 1 cut(s) 338
VpaK11BI GGWCC 1 cut(s) 469
XapI RAATTY 1 cut(s) 423
XmaI CCCGGG 1 cut(s) 241
XspI CTAG 2 cut(s) 45, 398
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.