pycom15g27500

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
OG0000158
Physical Location & Seq
Forward (+)
22998692 .. 22998934
243 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom15g27500.1

Sequence Viewer

Length: 243 bp
ATGGGTGACCCATTGGGAAGTTCTCGTGTGAGTTCCCAAAAACAAAACCGTGAGGGCGTGGTCGGGGCCCAAAGCGGACAATATCGTGCTACGGTGGTGGATCGAGCCCGGGAAGTGGTCCCCCCCGGGCCGGGATGTGACAATTTGGTATCAGAGCCTAACCTTGGTCGCGTGTGTGCTGACGAGGACGTCGGGCCCCTAAGGGGGGTGGATTGTGATATCCCACATCGCCCAGGGGAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

81

Amino Acids

8.41

Weight (kDa)

5.01

Isoelectric Point (pI)

35.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 188
AatII GACGTC 1 cut(s) 192
AccII CGCG 1 cut(s) 171
AciI CCGC 1 cut(s) 75
AclWI GGATC 1 cut(s) 108
AcyI GRCGYC 1 cut(s) 189
AfiI CCNNNNNNNGG 7 cut(s) 115, 130, 131, 164, 203, 204, 205
AjnI CCWGG 1 cut(s) 232
AlwI GGATC 1 cut(s) 108
Ama87I CYCGRG 2 cut(s) 108, 125
AoxI GGCC 3 cut(s) 66, 128, 194
ApaI GGGCCC 2 cut(s) 70, 198
AspS9I GGNCC 6 cut(s) 66, 67, 118, 128, 194, 195
AsuC2I CCSGG 5 cut(s) 109, 110, 126, 127, 132
AsuHPI GGTGA 1 cut(s) 17
AvaI CYCGRG 2 cut(s) 108, 125
AvaII GGWCC 1 cut(s) 118
AxyI CCTNAGG 1 cut(s) 200
BaeGI GKGCMC 2 cut(s) 70, 198
BanII GRGCYC 3 cut(s) 70, 109, 198
BauI CACGAG 1 cut(s) 24
BciT130I CCWGG 1 cut(s) 234
BcnI CCSGG 5 cut(s) 109, 110, 126, 127, 132
Bme1390I CCNGG 6 cut(s) 109, 110, 126, 127, 132, 234
Bme18I GGWCC 1 cut(s) 118
BmeT110I CYCGRG 2 cut(s) 108, 125
BmgT120I GGNCC 6 cut(s) 66, 67, 118, 128, 194, 195
BmiI GGNNCC 5 cut(s) 67, 68, 120, 196, 197
BmrFI CCNGG 6 cut(s) 109, 110, 126, 127, 132, 234
BpuMI CCSGG 5 cut(s) 109, 110, 126, 127, 132
BsaHI GRCGYC 1 cut(s) 189
BsaJI CCNNGG 6 cut(s) 108, 124, 125, 163, 232, 233
Bsc4I CCNNNNNNNGG 7 cut(s) 115, 130, 131, 164, 203, 204, 205
Bse21I CCTNAGG 1 cut(s) 200
BseBI CCWGG 1 cut(s) 234
BseDI CCNNGG 6 cut(s) 108, 124, 125, 163, 232, 233
BseGI GGATG 1 cut(s) 140
BseLI CCNNNNNNNGG 7 cut(s) 115, 130, 131, 164, 203, 204, 205
BseSI GKGCMC 2 cut(s) 70, 198
Bsh1236I CGCG 1 cut(s) 171
BshFI GGCC 3 cut(s) 68, 130, 196
BsiHKCI CYCGRG 2 cut(s) 108, 125
BsiSI CCGG 3 cut(s) 109, 126, 131
BslFI GGGAC 1 cut(s) 104
BslI CCNNNNNNNGG 7 cut(s) 115, 130, 131, 164, 203, 204, 205
BsmFI GGGAC 1 cut(s) 104
BsnI GGCC 3 cut(s) 68, 130, 196
BsoBI CYCGRG 2 cut(s) 108, 125
Bsp120I GGGCCC 2 cut(s) 66, 194
Bsp1286I GDGCHC 3 cut(s) 70, 109, 198
Bsp143I GATC 1 cut(s) 100
BspACI CCGC 1 cut(s) 75
BspANI GGCC 3 cut(s) 68, 130, 196
BspFNI CGCG 1 cut(s) 171
BspLI GGNNCC 5 cut(s) 67, 68, 120, 196, 197
BspPI GGATC 1 cut(s) 108
BssECI CCNNGG 6 cut(s) 108, 124, 125, 163, 232, 233
BssMI GATC 1 cut(s) 100
BssNI GRCGYC 1 cut(s) 189
BssSI CACGAG 1 cut(s) 24
BssT1I CCWWGG 1 cut(s) 163
Bst2BI CACGAG 1 cut(s) 24
Bst2UI CCWGG 1 cut(s) 234
Bst4CI ACNGT 2 cut(s) 50, 94
BstACI GRCGYC 1 cut(s) 189
BstDEI CTNAG 1 cut(s) 200
BstEII GGTNACC 1 cut(s) 5
BstF5I GGATG 1 cut(s) 140
BstFNI CGCG 1 cut(s) 171
BstKTI GATC 1 cut(s) 103
BstMBI GATC 1 cut(s) 100
BstNI CCWGG 1 cut(s) 234
BstPI GGTNACC 1 cut(s) 5
BstSCI CCNGG 6 cut(s) 107, 108, 124, 125, 130, 232
BstSLI GKGCMC 2 cut(s) 70, 198
BstUI CGCG 1 cut(s) 171
Bsu36I CCTNAGG 1 cut(s) 200
BsuRI GGCC 3 cut(s) 68, 130, 196
BtgZI GCGATG 1 cut(s) 212
BtsCI GGATG 1 cut(s) 140
Cfr13I GGNCC 6 cut(s) 66, 67, 118, 128, 194, 195
Cfr9I CCCGGG 2 cut(s) 108, 125
CviJI RGCY 5 cut(s) 68, 107, 130, 157, 196
CviKI_1 RGCY 5 cut(s) 68, 107, 130, 157, 196
DdeI CTNAG 1 cut(s) 200
DpnI GATC 1 cut(s) 102
DpnII GATC 1 cut(s) 100
DrdI GACNNNNNNGTC 1 cut(s) 188
DseDI GACNNNNNNGTC 1 cut(s) 188
Eco130I CCWWGG 1 cut(s) 163
Eco24I GRGCYC 3 cut(s) 70, 109, 198
Eco32I GATATC 1 cut(s) 220
Eco47I GGWCC 1 cut(s) 118
Eco81I CCTNAGG 1 cut(s) 200
Eco88I CYCGRG 2 cut(s) 108, 125
Eco91I GGTNACC 1 cut(s) 5
EcoO109I RGGNCCY 2 cut(s) 66, 195
EcoO65I GGTNACC 1 cut(s) 5
EcoRII CCWGG 1 cut(s) 232
EcoRV GATATC 1 cut(s) 220
EcoT14I CCWWGG 1 cut(s) 163
EcoT38I GRGCYC 3 cut(s) 70, 109, 198
ErhI CCWWGG 1 cut(s) 163
FaqI GGGAC 1 cut(s) 104
FokI GGATG 1 cut(s) 147
FriOI GRGCYC 3 cut(s) 70, 109, 198
HaeIII GGCC 3 cut(s) 68, 130, 196
HapII CCGG 3 cut(s) 109, 126, 131
Hin1I GRCGYC 1 cut(s) 189
HpaII CCGG 3 cut(s) 109, 126, 131
HphI GGTGA 1 cut(s) 17
Hpy188I TCNGA 1 cut(s) 154
Hpy99I CGWCG 1 cut(s) 194
HpyCH4III ACNGT 2 cut(s) 50, 94
HpyCH4IV ACGT 1 cut(s) 189
HpyF3I CTNAG 1 cut(s) 200
HpySE526I ACGT 1 cut(s) 189
Hsp92I GRCGYC 1 cut(s) 189
Kzo9I GATC 1 cut(s) 100
LpnPI CCDG 4 cut(s) 122, 139, 144, 219
MaeII ACGT 1 cut(s) 189
MaeIII GTNAC 2 cut(s) 5, 137
MalI GATC 1 cut(s) 102
MboI GATC 1 cut(s) 100
MhlI GDGCHC 3 cut(s) 70, 109, 198
MluCI AATT 1 cut(s) 142
MnlI CCTC 2 cut(s) 46, 178
MspI CCGG 3 cut(s) 109, 126, 131
MspR9I CCNGG 6 cut(s) 109, 110, 126, 127, 132, 234
MvaI CCWGG 1 cut(s) 234
MvnI CGCG 1 cut(s) 171
NciI CCSGG 5 cut(s) 109, 110, 126, 127, 132
NdeII GATC 1 cut(s) 100
NlaIV GGNNCC 5 cut(s) 67, 68, 120, 196, 197
NmuCI GTSAC 2 cut(s) 5, 137
PasI CCCWGGG 1 cut(s) 233
Psp6I CCWGG 1 cut(s) 232
PspEI GGTNACC 1 cut(s) 5
PspGI CCWGG 1 cut(s) 232
PspN4I GGNNCC 5 cut(s) 67, 68, 120, 196, 197
PspOMI GGGCCC 2 cut(s) 66, 194
PspPI GGNCC 6 cut(s) 66, 67, 118, 128, 194, 195
Sau3AI GATC 1 cut(s) 100
Sau96I GGNCC 6 cut(s) 66, 67, 118, 128, 194, 195
ScrFI CCNGG 6 cut(s) 109, 110, 126, 127, 132, 234
SduI GDGCHC 3 cut(s) 70, 109, 198
SetI ASST 2 cut(s) 165, 192
SinI GGWCC 1 cut(s) 118
SmaI CCCGGG 2 cut(s) 110, 127
Sse9I AATT 1 cut(s) 142
SsiI CCGC 1 cut(s) 75
StyD4I CCNGG 6 cut(s) 107, 108, 124, 125, 130, 232
StyI CCWWGG 1 cut(s) 163
TaaI ACNGT 2 cut(s) 50, 94
TaiI ACGT 1 cut(s) 192
TaqI TCGA 1 cut(s) 103
TasI AATT 1 cut(s) 142
TseFI GTSAC 2 cut(s) 5, 137
Tsp45I GTSAC 2 cut(s) 5, 137
TspMI CCCGGG 2 cut(s) 108, 125
VpaK11BI GGWCC 1 cut(s) 118
XmaI CCCGGG 2 cut(s) 108, 125
ZraI GACGTC 1 cut(s) 190
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.