MD13G1075400.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr13
OG0000158
Physical Location & Seq
Reverse (-)
5326794 .. 5327489
696 bp
Loading structure...
UTR
Exon/CDS
Intron
MD13G1075400.v1.1.491

Sequence Viewer

Length: 654 bp
ATGTTACAATCCACCCTCCTTAAGGGCCCGACGTCCTCATCGACACACTTCCGGCCAGGGATTGACTCTGATACCATTCTGGCCATCCTGGCCAGGGTCCACCACATCCCGGGCTCTCTCTATCACCATAGCACGATATTATCCGCTTTGGGCTTACCCATTCCCTCACGATTTTGTTTTTGGGAACTCACGAGCAACTTCCCAGTGGTCACCCATCTTGGGAGTGCTCTGGCCTTCTTCTCACTTAACTTCGGAGTTCCTACGGAACCTGAAGCCAGTAAGCTCCCAAAAGGCCTCGTGCTAGGTAGGGATGAGAATATACATTTAAGGATCACTCCCCTGGACGATGTGAGATGTTACAAAATAAATAGAAAAAACGTCAGGATGATTAATTACATTTTAAGGCCCTTGATTGAAGCTAATTTTCAAGTGTTACTTATATTCTTATGTGGCAGTTTATTTGACTTTTGGATTTTTGTTGGATGTTTAATTATACGTGGGTTTATGTTTAGAAATCATGATTTTTCAAGACCAATATCTAATGAACCCTTAAAATTAGAAAGTAATAGATTGGTGGGGTGGGTTTCATGTATCTATTTTGCAGAATATATAACAGAGTGGACCTCCTGGACAATAATTCGACTTAAAGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

218

Amino Acids

24.82

Weight (kDa)

8.88

Isoelectric Point (pI)

35.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 35
AciI CCGC 1 cut(s) 144
AclWI GGATC 1 cut(s) 338
AcoI YGGCCR 3 cut(s) 53, 81, 90
AcuI CTGAAG 1 cut(s) 291
AcyI GRCGYC 1 cut(s) 32
AfiI CCNNNNNNNGG 4 cut(s) 22, 94, 109, 219
AflII CTTAAG 1 cut(s) 20
AgsI TTSAA 3 cut(s) 416, 428, 528
AjnI CCWGG 5 cut(s) 55, 87, 92, 339, 626
AluBI AGCT 2 cut(s) 283, 419
AluI AGCT 2 cut(s) 283, 419
Alw21I GWGCWC 1 cut(s) 229
AlwI GGATC 1 cut(s) 338
Ama87I CYCGRG 1 cut(s) 109
AoxI GGCC 7 cut(s) 25, 53, 81, 90, 231, 292, 404
ApaI GGGCCC 1 cut(s) 29
AseI ATTAAT 1 cut(s) 390
AspS9I GGNCC 5 cut(s) 25, 26, 97, 405, 621
AsuC2I CCSGG 2 cut(s) 110, 111
AsuHPI GGTGA 2 cut(s) 116, 202
AvaI CYCGRG 1 cut(s) 109
AvaII GGWCC 2 cut(s) 97, 621
BaeGI GKGCMC 1 cut(s) 29
BalI TGGCCA 2 cut(s) 83, 92
BanII GRGCYC 2 cut(s) 29, 116
BauI CACGAG 2 cut(s) 190, 296
Bbv12I GWGCWC 1 cut(s) 229
BccI CCATC 2 cut(s) 92, 222
BciT130I CCWGG 5 cut(s) 57, 89, 94, 341, 628
BcnI CCSGG 2 cut(s) 110, 111
BfaI CTAG 2 cut(s) 302, 652
BfrI CTTAAG 1 cut(s) 20
BglI GCCNNNNNGGC 1 cut(s) 89
Bme1390I CCNGG 7 cut(s) 57, 89, 94, 110, 111, 341, 628
Bme18I GGWCC 2 cut(s) 97, 621
BmeT110I CYCGRG 1 cut(s) 109
BmgT120I GGNCC 5 cut(s) 25, 26, 97, 405, 621
BmiI GGNNCC 3 cut(s) 27, 98, 267
BmrFI CCNGG 7 cut(s) 57, 89, 94, 110, 111, 341, 628
BmrI ACTGGG 1 cut(s) 197
BmuI ACTGGG 1 cut(s) 197
BplI GAGNNNNNCTC 2 cut(s) 608, 640
BpuMI CCSGG 2 cut(s) 110, 111
BsaAI YACGTR 1 cut(s) 497
BsaHI GRCGYC 1 cut(s) 32
BsaJI CCNNGG 4 cut(s) 56, 93, 109, 339
Bsc4I CCNNNNNNNGG 4 cut(s) 22, 94, 109, 219
Bse1I ACTGG 2 cut(s) 203, 276
BseBI CCWGG 5 cut(s) 57, 89, 94, 341, 628
BseDI CCNNGG 4 cut(s) 56, 93, 109, 339
BseGI GGATG 5 cut(s) 84, 105, 316, 390, 488
BseLI CCNNNNNNNGG 4 cut(s) 22, 94, 109, 219
BseNI ACTGG 2 cut(s) 203, 276
BseSI GKGCMC 1 cut(s) 29
BshFI GGCC 7 cut(s) 27, 55, 83, 92, 233, 294, 406
BsiHKAI GWGCWC 1 cut(s) 229
BsiHKCI CYCGRG 1 cut(s) 109
BsiSI CCGG 2 cut(s) 52, 110
BslI CCNNNNNNNGG 4 cut(s) 22, 94, 109, 219
BsnI GGCC 7 cut(s) 27, 55, 83, 92, 233, 294, 406
BsoBI CYCGRG 1 cut(s) 109
Bsp120I GGGCCC 1 cut(s) 25
Bsp1286I GDGCHC 3 cut(s) 29, 116, 229
Bsp143I GATC 1 cut(s) 330
BspACI CCGC 1 cut(s) 144
BspANI GGCC 7 cut(s) 27, 55, 83, 92, 233, 294, 406
BspHI TCATGA 1 cut(s) 517
BspLI GGNNCC 3 cut(s) 27, 98, 267
BspPI GGATC 1 cut(s) 338
BspTI CTTAAG 1 cut(s) 20
BsrI ACTGG 2 cut(s) 203, 276
BssECI CCNNGG 4 cut(s) 56, 93, 109, 339
BssMI GATC 1 cut(s) 330
BssNI GRCGYC 1 cut(s) 32
BssSI CACGAG 2 cut(s) 190, 296
Bst2BI CACGAG 2 cut(s) 190, 296
Bst2UI CCWGG 5 cut(s) 57, 89, 94, 341, 628
BstACI GRCGYC 1 cut(s) 32
BstAFI CTTAAG 1 cut(s) 20
BstBAI YACGTR 1 cut(s) 497
BstEII GGTNACC 1 cut(s) 208
BstENI CCTNNNNNAGG 1 cut(s) 20
BstF5I GGATG 5 cut(s) 84, 105, 316, 390, 488
BstKTI GATC 1 cut(s) 333
BstMBI GATC 1 cut(s) 330
BstMWI GCNNNNNNNGC 1 cut(s) 89
BstNI CCWGG 5 cut(s) 57, 89, 94, 341, 628
BstPI GGTNACC 1 cut(s) 208
BstSCI CCNGG 7 cut(s) 55, 87, 92, 108, 109, 339, 626
BstSLI GKGCMC 1 cut(s) 29
BsuRI GGCC 7 cut(s) 27, 55, 83, 92, 233, 294, 406
BtsCI GGATG 5 cut(s) 84, 105, 316, 390, 488
BtsIMutI CAGTG 1 cut(s) 210
CciI TCATGA 1 cut(s) 517
Cfr13I GGNCC 5 cut(s) 25, 26, 97, 405, 621
Cfr9I CCCGGG 1 cut(s) 109
CviAII CATG 2 cut(s) 518, 588
DpnI GATC 1 cut(s) 332
DpnII GATC 1 cut(s) 330
EaeI YGGCCR 3 cut(s) 53, 81, 90
Eco147I AGGCCT 1 cut(s) 294
Eco24I GRGCYC 2 cut(s) 29, 116
Eco47I GGWCC 2 cut(s) 97, 621
Eco57I CTGAAG 1 cut(s) 291
Eco88I CYCGRG 1 cut(s) 109
Eco91I GGTNACC 1 cut(s) 208
EcoNI CCTNNNNNAGG 1 cut(s) 20
EcoO109I RGGNCCY 2 cut(s) 25, 405
EcoO65I GGTNACC 1 cut(s) 208
EcoRII CCWGG 5 cut(s) 55, 87, 92, 339, 626
EcoT38I GRGCYC 2 cut(s) 29, 116
FaeI CATG 2 cut(s) 521, 591
FalI AAGNNNNNCTT 2 cut(s) 420, 452
FatI CATG 2 cut(s) 517, 587
FokI GGATG 5 cut(s) 71, 92, 323, 397, 495
FriOI GRGCYC 2 cut(s) 29, 116
FspBI CTAG 2 cut(s) 302, 652
HaeIII GGCC 7 cut(s) 27, 55, 83, 92, 233, 294, 406
HapII CCGG 2 cut(s) 52, 110
Hin1I GRCGYC 1 cut(s) 32
Hin1II CATG 2 cut(s) 521, 591
HinfI GANTC 1 cut(s) 65
HpaII CCGG 2 cut(s) 52, 110
HphI GGTGA 2 cut(s) 116, 202
Hpy166II GTNNAC 2 cut(s) 100, 621
Hpy188I TCNGA 2 cut(s) 70, 254
Hpy188III TCNNGA 5 cut(s) 168, 190, 382, 518, 528
Hpy8I GTNNAC 2 cut(s) 100, 621
Hpy99I CGWCG 1 cut(s) 34
HpyAV CCTTC 1 cut(s) 244
HpyCH4IV ACGT 3 cut(s) 32, 378, 496
HpyCH4V TGCA 1 cut(s) 602
HpyF10VI GCNNNNNNNGC 1 cut(s) 89
HpySE526I ACGT 3 cut(s) 32, 378, 496
Hsp92I GRCGYC 1 cut(s) 32
Hsp92II CATG 2 cut(s) 521, 591
Kzo9I GATC 1 cut(s) 330
LmnI GCTCC 1 cut(s) 288
MaeI CTAG 2 cut(s) 302, 652
MaeII ACGT 3 cut(s) 32, 378, 496
MaeIII GTNAC 4 cut(s) 3, 208, 356, 432
MalI GATC 1 cut(s) 332
MboI GATC 1 cut(s) 330
MboII GAAGA 1 cut(s) 229
MhlI GDGCHC 3 cut(s) 29, 116, 229
MlsI TGGCCA 2 cut(s) 83, 92
MluCI AATT 5 cut(s) 391, 421, 489, 554, 636
MluNI TGGCCA 2 cut(s) 83, 92
MlyI GAGTC 1 cut(s) 59
MmeI TCCRAC 1 cut(s) 460
MnlI CCTC 5 cut(s) 26, 46, 175, 305, 634
Mox20I TGGCCA 2 cut(s) 83, 92
MscI TGGCCA 2 cut(s) 83, 92
MseI TTAA 8 cut(s) 21, 246, 326, 390, 401, 488, 551, 645
Msp20I TGGCCA 2 cut(s) 83, 92
MspCI CTTAAG 1 cut(s) 20
MspI CCGG 2 cut(s) 52, 110
MspR9I CCNGG 7 cut(s) 57, 89, 94, 110, 111, 341, 628
MvaI CCWGG 5 cut(s) 57, 89, 94, 341, 628
MwoI GCNNNNNNNGC 1 cut(s) 89
NciI CCSGG 2 cut(s) 110, 111
NdeII GATC 1 cut(s) 330
NlaIII CATG 2 cut(s) 521, 591
NlaIV GGNNCC 3 cut(s) 27, 98, 267
NmuCI GTSAC 1 cut(s) 208
PagI TCATGA 1 cut(s) 517
PceI AGGCCT 1 cut(s) 294
PcsI WCGNNNNNNNCGW 1 cut(s) 38
PfoI TCCNGGA 1 cut(s) 626
PleI GAGTC 1 cut(s) 59
PpsI GAGTC 1 cut(s) 59
Ppu21I YACGTR 1 cut(s) 497
PshBI ATTAAT 1 cut(s) 390
Psp6I CCWGG 5 cut(s) 55, 87, 92, 339, 626
PspEI GGTNACC 1 cut(s) 208
PspGI CCWGG 5 cut(s) 55, 87, 92, 339, 626
PspN4I GGNNCC 3 cut(s) 27, 98, 267
PspOMI GGGCCC 1 cut(s) 25
PspPI GGNCC 5 cut(s) 25, 26, 97, 405, 621
SaqAI TTAA 8 cut(s) 21, 246, 326, 390, 401, 488, 551, 645
Sau3AI GATC 1 cut(s) 330
Sau96I GGNCC 5 cut(s) 25, 26, 97, 405, 621
SchI GAGTC 1 cut(s) 59
ScrFI CCNGG 7 cut(s) 57, 89, 94, 110, 111, 341, 628
SduI GDGCHC 3 cut(s) 29, 116, 229
SetI ASST 8 cut(s) 35, 271, 285, 307, 381, 421, 499, 626
SfiI GGCCNNNNNGGCC 1 cut(s) 89
SinI GGWCC 2 cut(s) 97, 621
SmaI CCCGGG 1 cut(s) 111
SmlI CTYRAG 1 cut(s) 20
SmoI CTYRAG 1 cut(s) 20
Sse9I AATT 5 cut(s) 391, 421, 489, 554, 636
SseBI AGGCCT 1 cut(s) 294
SsiI CCGC 1 cut(s) 144
SspMI CTAG 2 cut(s) 302, 652
StuI AGGCCT 1 cut(s) 294
StyD4I CCNGG 7 cut(s) 55, 87, 92, 108, 109, 339, 626
TaiI ACGT 3 cut(s) 35, 381, 499
TaqI TCGA 2 cut(s) 41, 640
TasI AATT 5 cut(s) 391, 421, 489, 554, 636
Tru1I TTAA 8 cut(s) 21, 246, 326, 390, 401, 488, 551, 645
Tru9I TTAA 8 cut(s) 21, 246, 326, 390, 401, 488, 551, 645
TscAI CASTG 1 cut(s) 210
TseFI GTSAC 1 cut(s) 208
Tsp45I GTSAC 1 cut(s) 208
TspDTI ATGAA 2 cut(s) 558, 576
TspGWI ACGGA 1 cut(s) 278
TspMI CCCGGG 1 cut(s) 109
TspRI CASTG 1 cut(s) 210
Vha464I CTTAAG 1 cut(s) 20
VpaK11BI GGWCC 2 cut(s) 97, 621
VspI ATTAAT 1 cut(s) 390
XagI CCTNNNNNAGG 1 cut(s) 20
XmaI CCCGGG 1 cut(s) 109
XspI CTAG 2 cut(s) 302, 652
ZraI GACGTC 1 cut(s) 33
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.