pycom11g24050

Belongs to the iron ascorbate-dependent oxidoreductase family

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
Physical Location & Seq
Forward (+)
27060509 .. 27064270
3762 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 1005 bp
ATGCAAAAGCTAAGTATGGATAAAAAGGCATCTGCCGGGAAGAGCTTGTACGGTGGTTCTCTTCATGTTCCTAGTGTTCAGGAATTCGTAAAGAAGCCAATACTCACAATCCCAACAAGATACTTACAGCCTCATGATCAAGATGGTAACCAAGAGCATGAGATGATCATCAATTCTGATCATCATACTCCTCAAATACCATCCATTAACATGCAGAAATTGCTTTCCCAAGAATCAACCGATTCTGAAGCTGAACTAGCCAGGCTCCATTTTGCTTGCAAAGAGTGGGGTTTCTTCCAGGGAATGCACTTTTTTCTCTGGAATGAGCCAGCGAGCGAGAAGCATATCCACCGCCTGATGAGCCAGCAAGCGAGAGGGCATAATAGGAAGGAAAAATGCATTCCCAATTCCCTCAGCCTCCCGAAATTCAAATACTTCATCCATCCAAGGAATCTCACTCCTCCAATTTCAGGAATTGCATTCCTTATTTCAGGTGAGGTTCACCACACTGTTGATTCCCAGTATTTAGTAAACATCGAAACAATTTGTAATCGGAATTTAATTTCGTTTTTATTCCCATCACCCTCACCCTCACCCTTACCACATATGGTAAACCATGGTGTGAGCTCTTCCGTGTTGGAGAAAATGAAGACAGAAACTCAAGAGTTCTTCAACCTACCCATGGAGGAGAAAAAAAAGTTCTCGCAACAGCCAGGAGACATTGAAGGTTTGGACAATTTCTTCTTGACCACCCTTCCTGTCCAATTGAGGAAGCCTCACCTACTCCCAAAGCTCCCTTCTCCTTTCAGCACCAAGACATGTGCCCATAGACCAATAGCAACAGTGCAGCTACTAAGTTTGTATCTGTGCCCTCTATGGGCGTCACCATTGCTAAAAGGGCACAATACACTGTTTGGTGCTCAAAGAGACAGGCACAAATGGACCATTATTTGTGCCTGTTTTATCAGAAGACCTTTTCCAGCCATATTGACACTTAAATTATAA

Protein Analysis

335

Amino Acids

38.13

Weight (kDa)

9.26

Isoelectric Point (pI)

55.46

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DIOX_N PF14226 203 - 248 6.9e-10 non-haem dioxygenase in morphine synthesis N-terminal
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 1003
AciI CCGC 1 cut(s) 352
AcsI RAATTY 3 cut(s) 83, 425, 556
AcuI CTGAAG 1 cut(s) 267
AcyI GRCGYC 1 cut(s) 881
AfaI GTAC 1 cut(s) 50
AfiI CCNNNNNNNGG 3 cut(s) 470, 682, 877
AflIII ACRYGT 1 cut(s) 818
AgsI TTSAA 3 cut(s) 430, 673, 725
AjnI CCWGG 3 cut(s) 260, 297, 712
AjuI GAANNNNNNNTTGG 2 cut(s) 781, 813
AluBI AGCT 6 cut(s) 10, 45, 251, 627, 793, 850
AluI AGCT 6 cut(s) 10, 45, 251, 627, 793, 850
Alw21I GWGCWC 2 cut(s) 629, 922
Alw26I GTCTC 2 cut(s) 711, 921
ApeKI GCWGC 1 cut(s) 847
ApoI RAATTY 3 cut(s) 83, 425, 556
AspS9I GGNCC 1 cut(s) 942
AsuC2I CCSGG 1 cut(s) 37
AsuHPI GGTGA 7 cut(s) 494, 506, 573, 579, 585, 770, 876
AvaII GGWCC 1 cut(s) 942
BaeGI GKGCMC 3 cut(s) 826, 872, 903
BanII GRGCYC 1 cut(s) 629
BarI GAAGNNNNNNTAC 2 cut(s) 32, 64
BbsI GAAGAC 2 cut(s) 656, 976
Bbv12I GWGCWC 2 cut(s) 629, 922
BbvCI CCTCAGC 1 cut(s) 413
BbvI GCAGC 1 cut(s) 859
BccI CCATC 4 cut(s) 137, 208, 450, 586
BciT130I CCWGG 3 cut(s) 262, 299, 714
BclI TGATCA 3 cut(s) 136, 165, 178
BcnI CCSGG 1 cut(s) 37
BcoDI GTCTC 2 cut(s) 711, 921
BfaI CTAG 2 cut(s) 72, 257
BisI GCNGC 1 cut(s) 848
BlsI GCNGC 1 cut(s) 849
Bme1390I CCNGG 4 cut(s) 37, 262, 299, 714
Bme18I GGWCC 1 cut(s) 942
BmgT120I GGNCC 1 cut(s) 942
BmiI GGNNCC 1 cut(s) 266
BmrFI CCNGG 4 cut(s) 37, 262, 299, 714
BmrI ACTGGG 1 cut(s) 514
BmsI GCATC 1 cut(s) 38
BmuI ACTGGG 1 cut(s) 514
BpiI GAAGAC 2 cut(s) 656, 976
BplI GAGNNNNNCTC 2 cut(s) 760, 792
Bpu10I CCTNAGC 1 cut(s) 413
BpuEI CTTGAG 1 cut(s) 645
BpuMI CCSGG 1 cut(s) 37
BsaBI GATNNNNATC 1 cut(s) 167
BsaHI GRCGYC 1 cut(s) 881
BsaJI CCNNGG 4 cut(s) 298, 446, 616, 681
Bsc4I CCNNNNNNNGG 3 cut(s) 470, 682, 877
Bse1I ACTGG 1 cut(s) 520
Bse3DI GCAATG 1 cut(s) 887
Bse8I GATNNNNATC 1 cut(s) 167
BseBI CCWGG 3 cut(s) 262, 299, 714
BseDI CCNNGG 4 cut(s) 298, 446, 616, 681
BseGI GGATG 3 cut(s) 200, 438, 442
BseJI GATNNNNATC 1 cut(s) 167
BseLI CCNNNNNNNGG 3 cut(s) 470, 682, 877
BseMI GCAATG 1 cut(s) 887
BseMII CTCAG 1 cut(s) 427
BseNI ACTGG 1 cut(s) 520
BseRI GAGGAG 3 cut(s) 180, 450, 701
BseSI GKGCMC 3 cut(s) 826, 872, 903
BseXI GCAGC 1 cut(s) 859
BsgI GTGCAG 1 cut(s) 866
BsiHKAI GWGCWC 2 cut(s) 629, 922
BsiSI CCGG 1 cut(s) 36
BslI CCNNNNNNNGG 3 cut(s) 470, 682, 877
BsmAI GTCTC 2 cut(s) 711, 921
BsmI GAATGC 3 cut(s) 309, 399, 479
Bsp1286I GDGCHC 5 cut(s) 629, 826, 872, 903, 922
Bsp143I GATC 3 cut(s) 136, 165, 178
Bsp19I CCATGG 2 cut(s) 616, 681
BspACI CCGC 1 cut(s) 352
BspCNI CTCAG 1 cut(s) 426
BspHI TCATGA 1 cut(s) 133
BspLI GGNNCC 1 cut(s) 266
BspQI GCTCTTC 2 cut(s) 35, 634
BsrDI GCAATG 1 cut(s) 887
BsrI ACTGG 1 cut(s) 520
BssECI CCNNGG 4 cut(s) 298, 446, 616, 681
BssMI GATC 3 cut(s) 136, 165, 178
BssNI GRCGYC 1 cut(s) 881
BssT1I CCWWGG 3 cut(s) 446, 616, 681
Bst2UI CCWGG 3 cut(s) 262, 299, 714
Bst4CI ACNGT 4 cut(s) 53, 511, 844, 912
Bst6I CTCTTC 3 cut(s) 35, 66, 634
BstACI GRCGYC 1 cut(s) 881
BstAPI GCANNNNNTGC 1 cut(s) 220
BstC8I GCNNGC 5 cut(s) 277, 330, 334, 365, 369
BstDEI CTNAG 3 cut(s) 11, 413, 854
BstDSI CCRYGG 2 cut(s) 616, 681
BstEII GGTNACC 1 cut(s) 146
BstF5I GGATG 3 cut(s) 200, 438, 442
BstKTI GATC 3 cut(s) 139, 168, 181
BstMAI GTCTC 2 cut(s) 711, 921
BstMBI GATC 3 cut(s) 136, 165, 178
BstMWI GCNNNNNNNGC 4 cut(s) 220, 257, 360, 898
BstNI CCWGG 3 cut(s) 262, 299, 714
BstNSI RCATGY 2 cut(s) 214, 822
BstPI GGTNACC 1 cut(s) 146
BstSCI CCNGG 4 cut(s) 35, 260, 297, 712
BstSLI GKGCMC 3 cut(s) 826, 872, 903
BstV1I GCAGC 1 cut(s) 859
BstV2I GAAGAC 2 cut(s) 656, 976
BtgI CCRYGG 2 cut(s) 616, 681
BtsCI GGATG 3 cut(s) 200, 438, 442
BtsIMutI CAGTG 3 cut(s) 507, 849, 908
Cac8I GCNNGC 5 cut(s) 277, 330, 334, 365, 369
CciI TCATGA 1 cut(s) 133
Cfr13I GGNCC 1 cut(s) 942
CseI GACGC 1 cut(s) 870
Csp6I GTAC 1 cut(s) 49
CviAII CATG 7 cut(s) 65, 134, 158, 211, 617, 682, 819
CviQI GTAC 1 cut(s) 49
DdeI CTNAG 3 cut(s) 11, 413, 854
DpnI GATC 3 cut(s) 138, 167, 180
DpnII GATC 3 cut(s) 136, 165, 178
Eam1104I CTCTTC 3 cut(s) 35, 66, 634
EarI CTCTTC 3 cut(s) 35, 66, 634
Ecl136II GAGCTC 1 cut(s) 627
Eco130I CCWWGG 3 cut(s) 446, 616, 681
Eco24I GRGCYC 1 cut(s) 629
Eco47I GGWCC 1 cut(s) 942
Eco53kI GAGCTC 1 cut(s) 627
Eco57I CTGAAG 1 cut(s) 267
Eco91I GGTNACC 1 cut(s) 146
EcoICRI GAGCTC 1 cut(s) 627
EcoO65I GGTNACC 1 cut(s) 146
EcoRI GAATTC 1 cut(s) 83
EcoRII CCWGG 3 cut(s) 260, 297, 712
EcoT14I CCWWGG 3 cut(s) 446, 616, 681
EcoT22I ATGCAT 1 cut(s) 401
EcoT38I GRGCYC 1 cut(s) 629
ErhI CCWWGG 3 cut(s) 446, 616, 681
FaeI CATG 7 cut(s) 68, 137, 161, 214, 620, 685, 822
FatI CATG 7 cut(s) 64, 133, 157, 210, 616, 681, 818
FauNDI CATATG 1 cut(s) 606
FbaI TGATCA 3 cut(s) 136, 165, 178
Fnu4HI GCNGC 1 cut(s) 848
FokI GGATG 3 cut(s) 187, 425, 429
FriOI GRGCYC 1 cut(s) 629
Fsp4HI GCNGC 1 cut(s) 848
FspBI CTAG 2 cut(s) 72, 257
GluI GCNGC 1 cut(s) 848
HapII CCGG 1 cut(s) 36
HgaI GACGC 1 cut(s) 870
Hin1I GRCGYC 1 cut(s) 881
Hin1II CATG 7 cut(s) 68, 137, 161, 214, 620, 685, 822
HinfI GANTC 4 cut(s) 233, 242, 451, 515
HpaII CCGG 1 cut(s) 36
HphI GGTGA 7 cut(s) 494, 506, 573, 579, 585, 770, 876
Hpy166II GTNNAC 3 cut(s) 502, 532, 613
Hpy188I TCNGA 4 cut(s) 178, 247, 555, 968
Hpy188III TCNNGA 8 cut(s) 80, 134, 140, 319, 421, 471, 662, 745
Hpy8I GTNNAC 3 cut(s) 502, 532, 613
HpyAV CCTTC 4 cut(s) 382, 719, 764, 807
HpyCH4III ACNGT 4 cut(s) 53, 511, 844, 912
HpyCH4V TGCA 7 cut(s) 4, 214, 279, 307, 399, 479, 847
HpyF10VI GCNNNNNNNGC 4 cut(s) 220, 257, 360, 898
HpyF3I CTNAG 3 cut(s) 11, 413, 854
Hsp92I GRCGYC 1 cut(s) 881
Hsp92II CATG 7 cut(s) 68, 137, 161, 214, 620, 685, 822
Ksp22I TGATCA 3 cut(s) 136, 165, 178
Kzo9I GATC 3 cut(s) 136, 165, 178
LguI GCTCTTC 2 cut(s) 35, 634
LmnI GCTCC 2 cut(s) 270, 798
Lsp1109I GCAGC 1 cut(s) 859
LweI GCATC 1 cut(s) 38
MaeI CTAG 2 cut(s) 72, 257
MaeIII GTNAC 2 cut(s) 146, 882
MalI GATC 3 cut(s) 138, 167, 180
MboI GATC 3 cut(s) 136, 165, 178
MboII GAAGA 8 cut(s) 52, 53, 286, 621, 661, 661, 733, 981
MfeI CAATTG 1 cut(s) 764
MhlI GDGCHC 5 cut(s) 629, 826, 872, 903, 922
MmeI TCCRAC 1 cut(s) 618
Mph1103I ATGCAT 1 cut(s) 401
MseI TTAA 3 cut(s) 207, 560, 996
MslI CAYNNNNRTG 1 cut(s) 209
MspI CCGG 1 cut(s) 36
MspR9I CCNGG 4 cut(s) 37, 262, 299, 714
MunI CAATTG 1 cut(s) 764
Mva1269I GAATGC 3 cut(s) 309, 399, 479
MvaI CCWGG 3 cut(s) 262, 299, 714
MwoI GCNNNNNNNGC 4 cut(s) 220, 257, 360, 898
NciI CCSGG 1 cut(s) 37
NcoI CCATGG 2 cut(s) 616, 681
NdeI CATATG 1 cut(s) 606
NdeII GATC 3 cut(s) 136, 165, 178
NlaIII CATG 7 cut(s) 68, 137, 161, 214, 620, 685, 822
NlaIV GGNNCC 1 cut(s) 266
NmuCI GTSAC 1 cut(s) 882
NsiI ATGCAT 1 cut(s) 401
NspI RCATGY 2 cut(s) 214, 822
PagI TCATGA 1 cut(s) 133
PciI ACATGT 1 cut(s) 818
PciSI GCTCTTC 2 cut(s) 35, 634
PctI GAATGC 3 cut(s) 309, 399, 479
PfeI GAWTC 4 cut(s) 233, 242, 451, 515
PkrI GCNGC 1 cut(s) 849
PscI ACATGT 1 cut(s) 818
PsiI TTATAA 1 cut(s) 1003
Psp124BI GAGCTC 1 cut(s) 629
Psp6I CCWGG 3 cut(s) 260, 297, 712
PspEI GGTNACC 1 cut(s) 146
PspGI CCWGG 3 cut(s) 260, 297, 712
PspN4I GGNNCC 1 cut(s) 266
PspPI GGNCC 1 cut(s) 942
RsaI GTAC 1 cut(s) 50
RsaNI GTAC 1 cut(s) 49
RseI CAYNNNNRTG 1 cut(s) 209
SacI GAGCTC 1 cut(s) 629
SapI GCTCTTC 2 cut(s) 35, 634
SaqAI TTAA 3 cut(s) 207, 560, 996
SatI GCNGC 1 cut(s) 848
Sau3AI GATC 3 cut(s) 136, 165, 178
Sau96I GGNCC 1 cut(s) 942
ScrFI CCNGG 4 cut(s) 37, 262, 299, 714
SduI GDGCHC 5 cut(s) 629, 826, 872, 903, 922
SfaNI GCATC 1 cut(s) 38
SinI GGWCC 1 cut(s) 942
SmiMI CAYNNNNRTG 1 cut(s) 209
SmlI CTYRAG 1 cut(s) 660
SmoI CTYRAG 1 cut(s) 660
SsiI CCGC 1 cut(s) 352
SspMI CTAG 2 cut(s) 72, 257
SstI GAGCTC 1 cut(s) 629
StyD4I CCNGG 4 cut(s) 35, 260, 297, 712
StyI CCWWGG 3 cut(s) 446, 616, 681
TaaI ACNGT 4 cut(s) 53, 511, 844, 912
TaqI TCGA 1 cut(s) 537
TfiI GAWTC 4 cut(s) 233, 242, 451, 515
Tru1I TTAA 3 cut(s) 207, 560, 996
Tru9I TTAA 3 cut(s) 207, 560, 996
TscAI CASTG 3 cut(s) 514, 849, 915
TseFI GTSAC 1 cut(s) 882
TseI GCWGC 1 cut(s) 847
Tsp45I GTSAC 1 cut(s) 882
TspDTI ATGAA 3 cut(s) 53, 427, 662
TspGWI ACGGA 1 cut(s) 622
TspRI CASTG 3 cut(s) 514, 849, 915
VpaK11BI GGWCC 1 cut(s) 942
XapI RAATTY 3 cut(s) 83, 425, 556
XceI RCATGY 2 cut(s) 214, 822
XspI CTAG 2 cut(s) 72, 257
Zsp2I ATGCAT 1 cut(s) 401
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.