pycom12g09660

transposition, RNA-mediated

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
Physical Location & Seq
Forward (+)
11504564 .. 11506693
2130 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 1545 bp
ATGAATTTGATCGATCTAGAATATAAGGGAATTTCACCCAATAGTTATGAACTTATATTTATAAGTAGTGGAGGCTTTACGAATGTCATGTCAATGCTTATGGTTTTCATAGAACTTAATGATCGATCAACTTTTTGCTATGTATCTCTATCATGCAGTTCATATAAGGAACTTGATAAGAATAATTTGATTTTTACGGTTAACTTGGGGCATTGTCATTCATGGCTTATAGGAATAATAACTGAAAATCGATTTGTATGCATATGTGTCATGTTTTGTCCAAAGTTGTATAGAGTTTTTAAATCTGTTTGCTTTTACTTTAAATTCATCAAAAACCACTTCCCCCTTTATATTTTGTGTCTTTTAGTTAGAATCTGTTTAAATTGGTTTCTTTTTAGTGTTTTGAGTCAACATAATCAATTTGTTTGTTTTGTGCTTGTAATTGAGTCTAATTTGAGTAGATTAGCAATACTACAACCATCTAAAAGAGGGTTTAATTTGTGTGCTAATTTATATCACATCAAAGGACAACCCTTCGTGCAACATCTTGGAAAGCTAATAACCATGTGGAACGAATTGAATGTCTATCGTCCCCACACCATTGATGCTATGATGCTAATAAAGAAGGCTGAGGAAGACAAAATCTTCCAGCTTTTGGCAAGCCTCAGTTCTGAGTTCGAAGACTTTCGAAGTCACATTCTGATGAACCCTGATGTGCCCTCATTCTCTAGTGTTTGTGCTACTATTCAGCGAGAGGAGGCGCACAGAAAGGTAATGAACATGGCAGTCAAGCTAAGCATGCCAGAAGTTGATAGGAGCATATTTATGCTACTTAGTTATGTTGTTGCCTTCTATTTTCGTATGTTTTTAGGTCCTAATGGAAAAAGGAGCAAGAAAGTGCATTTTGAAGCTATTTGGAGCAGTTTTGGGCATGGATTGGATAGCTTAACTATGGAGCAAAATGGATGGATGAAATTGAAGTCAAGAGGGGCTAGGAAAGGCTACAAATATGGAGGAAGAAGAACCTTATCCAACCTTATCTTATCCTATCCTAACCAACCTTATCCTTTCCTAACTATAACATTATCCTATCTTATCCTATCCAAATCAGGTTGTGCCTTAAATCTATCATATTCTAGAAGCCTAATCCCTTTGTATGCCGCATGTAGGCCATTCCTTGTAGGTTTAGGAGTTGTAATCCTTCCTCTGTACCTATGCCATAACACCCTATCTTCCTCCTACATGTGTACCGCACCTATCCTTCTAGAAGTCCCTAAAACCTTGCCATGTATCCCCTATTCCATTCCCTTTTGGTTTCTGCCAAGACTTAACCCTTTTCCCATTGGATTAAATACAACCCTATGCCACACCATTCAAATCATCCATTCACTCATTCATTCATTCATACTTTCATCCATCAAACACCATAATTCACACTACATCACCCTAGTGCCCCAAGGGAGTGCCGTGCATGCCATTGGATTCAATGTTTATGTTAATTTGGTTTTCAATTATGATGAACATGTGGAACTAATTTCTTTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

515

Amino Acids

59.02

Weight (kDa)

9.08

Isoelectric Point (pI)

46.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 62
AccB7I CCANNNNNTGG 1 cut(s) 655
AciI CCGC 2 cut(s) 1161, 1251
AcsI RAATTY 3 cut(s) 4, 30, 323
AfaI GTAC 2 cut(s) 1211, 1249
AfiI CCNNNNNNNGG 2 cut(s) 655, 1167
AflIII ACRYGT 2 cut(s) 1242, 1522
AgsI TTSAA 6 cut(s) 580, 908, 979, 1376, 1486, 1510
AleI CACNNNNGTG 1 cut(s) 1448
AluBI AGCT 5 cut(s) 556, 652, 793, 911, 945
AluI AGCT 5 cut(s) 556, 652, 793, 911, 945
AoxI GGCC 1 cut(s) 1169
ApoI RAATTY 3 cut(s) 4, 30, 323
ArsI GACNNNNNNTTYG 4 cut(s) 74, 106, 567, 599
Asp700I GAANNNNTTC 1 cut(s) 684
AspLEI GCGC 1 cut(s) 763
AspS9I GGNCC 1 cut(s) 872
AsuHPI GGTGA 2 cut(s) 27, 1435
AsuII TTCGAA 2 cut(s) 678, 688
AvaII GGWCC 1 cut(s) 872
BaeGI GKGCMC 2 cut(s) 720, 1455
BaeI ACNNNNGTAYC 2 cut(s) 1231, 1264
BbsI GAAGAC 2 cut(s) 642, 687
BbvCI CCTCAGC 1 cut(s) 630
BccI CCATC 3 cut(s) 487, 960, 1424
BceAI ACGGC 1 cut(s) 1451
BcgI CGANNNNNNTGC 2 cut(s) 240, 274
BciVI GTATCC 1 cut(s) 1301
BfaI CTAG 6 cut(s) 17, 729, 993, 1137, 1265, 1448
BfuI GTATCC 1 cut(s) 1301
BisI GCNGC 1 cut(s) 1161
BlpI GCTNAGC 1 cut(s) 794
BlsI GCNGC 1 cut(s) 1162
Bme18I GGWCC 1 cut(s) 872
BmgT120I GGNCC 1 cut(s) 872
BmsI GCATC 2 cut(s) 595, 603
BpiI GAAGAC 2 cut(s) 642, 687
Bpu10I CCTNAGC 1 cut(s) 630
Bpu1102I GCTNAGC 1 cut(s) 794
Bpu14I TTCGAA 2 cut(s) 678, 688
Bsa29I ATCGAT 3 cut(s) 12, 124, 250
BsaJI CCNNGG 1 cut(s) 1456
Bsc4I CCNNNNNNNGG 2 cut(s) 655, 1167
BseCI ATCGAT 3 cut(s) 12, 124, 250
BseDI CCNNGG 1 cut(s) 1456
BseGI GGATG 4 cut(s) 971, 975, 1380, 1412
BseLI CCNNNNNNNGG 2 cut(s) 655, 1167
BseMII CTCAG 3 cut(s) 621, 663, 679
BseRI GAGGAG 1 cut(s) 770
BseSI GKGCMC 2 cut(s) 720, 1455
BshFI GGCC 1 cut(s) 1171
BshVI ATCGAT 3 cut(s) 12, 124, 250
BslFI GGGAC 2 cut(s) 576, 1256
BslI CCNNNNNNNGG 2 cut(s) 655, 1167
BsmFI GGGAC 2 cut(s) 576, 1256
BsnI GGCC 1 cut(s) 1171
Bsp119I TTCGAA 2 cut(s) 678, 688
Bsp1286I GDGCHC 2 cut(s) 720, 1455
Bsp143I GATC 4 cut(s) 9, 13, 121, 125
Bsp1720I GCTNAGC 1 cut(s) 794
BspACI CCGC 2 cut(s) 1161, 1251
BspANI GGCC 1 cut(s) 1171
BspCNI CTCAG 3 cut(s) 622, 664, 678
BspDI ATCGAT 3 cut(s) 12, 124, 250
BspT104I TTCGAA 2 cut(s) 678, 688
BssECI CCNNGG 1 cut(s) 1456
BssMI GATC 4 cut(s) 9, 13, 121, 125
BssT1I CCWWGG 1 cut(s) 1456
Bst4CI ACNGT 1 cut(s) 199
BstBI TTCGAA 2 cut(s) 678, 688
BstC8I GCNNGC 3 cut(s) 661, 800, 1473
BstDEI CTNAG 5 cut(s) 630, 665, 672, 794, 833
BstF5I GGATG 4 cut(s) 971, 975, 1380, 1412
BstHHI GCGC 1 cut(s) 763
BstKTI GATC 4 cut(s) 12, 16, 124, 128
BstMBI GATC 4 cut(s) 9, 13, 121, 125
BstMWI GCNNNNNNNGC 2 cut(s) 799, 1472
BstNSI RCATGY 5 cut(s) 802, 1167, 1246, 1475, 1526
BstSLI GKGCMC 2 cut(s) 720, 1455
BstV2I GAAGAC 2 cut(s) 642, 687
Bsu15I ATCGAT 3 cut(s) 12, 124, 250
BsuI GTATCC 1 cut(s) 1301
BsuRI GGCC 1 cut(s) 1171
BsuTUI ATCGAT 3 cut(s) 12, 124, 250
BtsCI GGATG 4 cut(s) 971, 975, 1380, 1412
Cac8I GCNNGC 3 cut(s) 661, 800, 1473
CfoI GCGC 1 cut(s) 763
Cfr13I GGNCC 1 cut(s) 872
ClaI ATCGAT 3 cut(s) 12, 124, 250
Csp6I GTAC 2 cut(s) 1210, 1248
CviQI GTAC 2 cut(s) 1210, 1248
DdeI CTNAG 5 cut(s) 630, 665, 672, 794, 833
DpnI GATC 4 cut(s) 11, 15, 123, 127
DpnII GATC 4 cut(s) 9, 13, 121, 125
DraI TTTAAA 3 cut(s) 301, 322, 381
Eco130I CCWWGG 1 cut(s) 1456
Eco47I GGWCC 1 cut(s) 872
EcoO109I RGGNCCY 1 cut(s) 872
EcoT14I CCWWGG 1 cut(s) 1456
EcoT22I ATGCAT 1 cut(s) 263
ErhI CCWWGG 1 cut(s) 1456
FaqI GGGAC 2 cut(s) 576, 1256
FauNDI CATATG 1 cut(s) 263
Fnu4HI GCNGC 1 cut(s) 1161
FokI GGATG 4 cut(s) 978, 982, 1367, 1399
Fsp4HI GCNGC 1 cut(s) 1161
FspBI CTAG 6 cut(s) 17, 729, 993, 1137, 1265, 1448
GlaI GCGC 1 cut(s) 762
GluI GCNGC 1 cut(s) 1161
HaeIII GGCC 1 cut(s) 1171
HhaI GCGC 1 cut(s) 763
Hin6I GCGC 1 cut(s) 761
HinP1I GCGC 1 cut(s) 761
HincII GTYRAC 2 cut(s) 202, 410
HindII GTYRAC 2 cut(s) 202, 410
HinfI GANTC 4 cut(s) 372, 406, 446, 1482
HpaI GTTAAC 1 cut(s) 202
HphI GGTGA 2 cut(s) 27, 1435
Hpy166II GTNNAC 3 cut(s) 202, 410, 1248
Hpy188I TCNGA 2 cut(s) 673, 702
Hpy188III TCNNGA 4 cut(s) 17, 984, 1137, 1265
Hpy8I GTNNAC 3 cut(s) 202, 410, 1248
HpyAV CCTTC 5 cut(s) 544, 619, 859, 1211, 1271
HpyCH4III ACNGT 1 cut(s) 199
HpyCH4V TGCA 5 cut(s) 156, 261, 541, 901, 1471
HpyF10VI GCNNNNNNNGC 2 cut(s) 799, 1472
HpyF3I CTNAG 5 cut(s) 630, 665, 672, 794, 833
HspAI GCGC 1 cut(s) 761
KspAI GTTAAC 1 cut(s) 202
Kzo9I GATC 4 cut(s) 9, 13, 121, 125
LmnI GCTCC 4 cut(s) 816, 888, 918, 955
LpnPI CCDG 4 cut(s) 662, 723, 816, 1095
LweI GCATC 2 cut(s) 595, 603
MaeI CTAG 6 cut(s) 17, 729, 993, 1137, 1265, 1448
MaeIII GTNAC 1 cut(s) 692
MalI GATC 4 cut(s) 11, 15, 123, 127
MboI GATC 4 cut(s) 9, 13, 121, 125
MboII GAAGA 6 cut(s) 637, 647, 692, 1029, 1032, 1224
MhlI GDGCHC 2 cut(s) 720, 1455
MlyI GAGTC 2 cut(s) 415, 455
MmeI TCCRAC 1 cut(s) 1056
Mph1103I ATGCAT 1 cut(s) 263
MroXI GAANNNNTTC 1 cut(s) 684
MslI CAYNNNNRTG 4 cut(s) 92, 701, 824, 1448
MwoI GCNNNNNNNGC 2 cut(s) 799, 1472
NdeI CATATG 1 cut(s) 263
NdeII GATC 4 cut(s) 9, 13, 121, 125
NmuCI GTSAC 1 cut(s) 692
NsiI ATGCAT 1 cut(s) 263
NspI RCATGY 5 cut(s) 802, 1167, 1246, 1475, 1526
NspV TTCGAA 2 cut(s) 678, 688
OliI CACNNNNGTG 1 cut(s) 1448
PaeI GCATGC 2 cut(s) 802, 1475
PciI ACATGT 2 cut(s) 1242, 1522
PdmI GAANNNNTTC 1 cut(s) 684
PfeI GAWTC 2 cut(s) 372, 1482
PflMI CCANNNNNTGG 1 cut(s) 655
PkrI GCNGC 1 cut(s) 1162
PleI GAGTC 2 cut(s) 414, 454
PpsI GAGTC 2 cut(s) 414, 454
PpuMI RGGWCCY 1 cut(s) 872
PscI ACATGT 2 cut(s) 1242, 1522
PsiI TTATAA 1 cut(s) 62
Psp5II RGGWCCY 1 cut(s) 872
PspPI GGNCC 1 cut(s) 872
PspPPI RGGWCCY 1 cut(s) 872
RsaI GTAC 2 cut(s) 1211, 1249
RsaNI GTAC 2 cut(s) 1210, 1248
RseI CAYNNNNRTG 4 cut(s) 92, 701, 824, 1448
SatI GCNGC 1 cut(s) 1161
Sau3AI GATC 4 cut(s) 9, 13, 121, 125
Sau96I GGNCC 1 cut(s) 872
SchI GAGTC 2 cut(s) 415, 455
SduI GDGCHC 2 cut(s) 720, 1455
SfaNI GCATC 2 cut(s) 595, 603
SfuI TTCGAA 2 cut(s) 678, 688
SinI GGWCC 1 cut(s) 872
SmiMI CAYNNNNRTG 4 cut(s) 92, 701, 824, 1448
SphI GCATGC 2 cut(s) 802, 1475
SsiI CCGC 2 cut(s) 1161, 1251
SspMI CTAG 6 cut(s) 17, 729, 993, 1137, 1265, 1448
StyI CCWWGG 1 cut(s) 1456
TaaI ACNGT 1 cut(s) 199
TaqI TCGA 5 cut(s) 12, 124, 250, 678, 688
TauI GCSGC 1 cut(s) 1163
TfiI GAWTC 2 cut(s) 372, 1482
TseFI GTSAC 1 cut(s) 692
Tsp45I GTSAC 1 cut(s) 692
Van91I CCANNNNNTGG 1 cut(s) 655
VpaK11BI GGWCC 1 cut(s) 872
XapI RAATTY 3 cut(s) 4, 30, 323
XbaI TCTAGA 3 cut(s) 16, 1136, 1264
XceI RCATGY 5 cut(s) 802, 1167, 1246, 1475, 1526
XmnI GAANNNNTTC 1 cut(s) 684
XspI CTAG 6 cut(s) 17, 729, 993, 1137, 1265, 1448
Zsp2I ATGCAT 1 cut(s) 263
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.