pycom13g08800

Belongs to the class-I aminoacyl-tRNA synthetase family

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
Physical Location & Seq
Reverse (-)
5829253 .. 5829486
234 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 234 bp
ATGTCACAATCCACCCCCCTTAGGGGCCCGACGTCCTCGTCGGCACACACGCAACCAGGATTAGGCTCTGATACCAAATTGTCACATCCCGGCCCGGGGCGGATCACTTCCCGAGCCTGCTCCACCACCGTAGCACGATATTGTCCGCTTTGGGCTTACCATTCCCTCACGGTTTTGTTTTTGGGAACTCACGAGCAACTTCCCAGTGGGTCACCCATTATGGGATTGCTCTAG

Protein Analysis

78

Amino Acids

8.11

Weight (kDa)

9.38

Isoelectric Point (pI)

50.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 37
AatII GACGTC 1 cut(s) 35
AciI CCGC 2 cut(s) 100, 146
AclWI GGATC 1 cut(s) 110
AcyI GRCGYC 1 cut(s) 32
AfiI CCNNNNNNNGG 7 cut(s) 21, 22, 23, 62, 95, 96, 221
AjnI CCWGG 1 cut(s) 55
AlwI GGATC 1 cut(s) 110
Ama87I CYCGRG 2 cut(s) 94, 111
AoxI GGCC 2 cut(s) 25, 91
ApaI GGGCCC 1 cut(s) 29
AspS9I GGNCC 3 cut(s) 25, 26, 92
AsuC2I CCSGG 3 cut(s) 90, 95, 96
AsuHPI GGTGA 1 cut(s) 204
AvaI CYCGRG 2 cut(s) 94, 111
AxyI CCTNAGG 1 cut(s) 20
BaeGI GKGCMC 1 cut(s) 29
BanII GRGCYC 1 cut(s) 29
BauI CACGAG 1 cut(s) 191
BciT130I CCWGG 1 cut(s) 57
BcnI CCSGG 3 cut(s) 90, 95, 96
BfaI CTAG 1 cut(s) 232
Bme1390I CCNGG 4 cut(s) 57, 90, 95, 96
BmeT110I CYCGRG 2 cut(s) 94, 111
BmgT120I GGNCC 3 cut(s) 25, 26, 92
BmiI GGNNCC 2 cut(s) 26, 27
BmrFI CCNGG 4 cut(s) 57, 90, 95, 96
BmrI ACTGGG 1 cut(s) 198
BmuI ACTGGG 1 cut(s) 198
BpuMI CCSGG 3 cut(s) 90, 95, 96
BsaHI GRCGYC 1 cut(s) 32
BsaJI CCNNGG 2 cut(s) 94, 95
Bsc4I CCNNNNNNNGG 7 cut(s) 21, 22, 23, 62, 95, 96, 221
Bse1I ACTGG 1 cut(s) 204
Bse21I CCTNAGG 1 cut(s) 20
BseBI CCWGG 1 cut(s) 57
BseDI CCNNGG 2 cut(s) 94, 95
BseGI GGATG 1 cut(s) 85
BseLI CCNNNNNNNGG 7 cut(s) 21, 22, 23, 62, 95, 96, 221
BseNI ACTGG 1 cut(s) 204
BseSI GKGCMC 1 cut(s) 29
BshFI GGCC 2 cut(s) 27, 93
BsiHKCI CYCGRG 2 cut(s) 94, 111
BsiSI CCGG 2 cut(s) 90, 95
BslI CCNNNNNNNGG 7 cut(s) 21, 22, 23, 62, 95, 96, 221
BsnI GGCC 2 cut(s) 27, 93
BsoBI CYCGRG 2 cut(s) 94, 111
Bsp120I GGGCCC 1 cut(s) 25
Bsp1286I GDGCHC 1 cut(s) 29
Bsp143I GATC 1 cut(s) 102
BspACI CCGC 2 cut(s) 100, 146
BspANI GGCC 2 cut(s) 27, 93
BspLI GGNNCC 2 cut(s) 26, 27
BspPI GGATC 1 cut(s) 110
BsrI ACTGG 1 cut(s) 204
BssECI CCNNGG 2 cut(s) 94, 95
BssMI GATC 1 cut(s) 102
BssNI GRCGYC 1 cut(s) 32
BssSI CACGAG 1 cut(s) 191
Bst2BI CACGAG 1 cut(s) 191
Bst2UI CCWGG 1 cut(s) 57
Bst4CI ACNGT 2 cut(s) 130, 172
BstACI GRCGYC 1 cut(s) 32
BstC8I GCNNGC 1 cut(s) 118
BstDEI CTNAG 1 cut(s) 20
BstEII GGTNACC 1 cut(s) 210
BstF5I GGATG 1 cut(s) 85
BstKTI GATC 1 cut(s) 105
BstMBI GATC 1 cut(s) 102
BstNI CCWGG 1 cut(s) 57
BstPI GGTNACC 1 cut(s) 210
BstSCI CCNGG 4 cut(s) 55, 88, 93, 94
BstSLI GKGCMC 1 cut(s) 29
Bsu36I CCTNAGG 1 cut(s) 20
BsuRI GGCC 2 cut(s) 27, 93
BtsCI GGATG 1 cut(s) 85
BtsIMutI CAGTG 1 cut(s) 211
Cac8I GCNNGC 1 cut(s) 118
Cfr13I GGNCC 3 cut(s) 25, 26, 92
Cfr9I CCCGGG 1 cut(s) 94
CviJI RGCY 5 cut(s) 27, 66, 93, 116, 155
CviKI_1 RGCY 5 cut(s) 27, 66, 93, 116, 155
DdeI CTNAG 1 cut(s) 20
DpnI GATC 1 cut(s) 104
DpnII GATC 1 cut(s) 102
DrdI GACNNNNNNGTC 1 cut(s) 37
DseDI GACNNNNNNGTC 1 cut(s) 37
EciI GGCGGA 1 cut(s) 115
Eco24I GRGCYC 1 cut(s) 29
Eco81I CCTNAGG 1 cut(s) 20
Eco88I CYCGRG 2 cut(s) 94, 111
Eco91I GGTNACC 1 cut(s) 210
EcoO109I RGGNCCY 1 cut(s) 25
EcoO65I GGTNACC 1 cut(s) 210
EcoRII CCWGG 1 cut(s) 55
EcoT38I GRGCYC 1 cut(s) 29
FaiI YATR 1 cut(s) 221
FokI GGATG 1 cut(s) 72
FriOI GRGCYC 1 cut(s) 29
FspBI CTAG 1 cut(s) 232
HaeIII GGCC 2 cut(s) 27, 93
HapII CCGG 2 cut(s) 90, 95
Hin1I GRCGYC 1 cut(s) 32
HpaII CCGG 2 cut(s) 90, 95
HphI GGTGA 1 cut(s) 204
Hpy188I TCNGA 1 cut(s) 70
Hpy188III TCNNGA 2 cut(s) 111, 191
Hpy99I CGWCG 2 cut(s) 34, 43
HpyCH4III ACNGT 2 cut(s) 130, 172
HpyCH4IV ACGT 1 cut(s) 32
HpyF3I CTNAG 1 cut(s) 20
HpySE526I ACGT 1 cut(s) 32
Hsp92I GRCGYC 1 cut(s) 32
Kzo9I GATC 1 cut(s) 102
LmnI GCTCC 1 cut(s) 125
LpnPI CCDG 6 cut(s) 42, 69, 103, 108, 130, 217
MaeI CTAG 1 cut(s) 232
MaeII ACGT 1 cut(s) 32
MaeIII GTNAC 3 cut(s) 3, 81, 210
MalI GATC 1 cut(s) 104
MboI GATC 1 cut(s) 102
MhlI GDGCHC 1 cut(s) 29
MluCI AATT 1 cut(s) 77
MnlI CCTC 2 cut(s) 46, 176
MspI CCGG 2 cut(s) 90, 95
MspR9I CCNGG 4 cut(s) 57, 90, 95, 96
MvaI CCWGG 1 cut(s) 57
NciI CCSGG 3 cut(s) 90, 95, 96
NdeII GATC 1 cut(s) 102
NlaIV GGNNCC 2 cut(s) 26, 27
NmuCI GTSAC 3 cut(s) 3, 81, 210
Psp6I CCWGG 1 cut(s) 55
PspEI GGTNACC 1 cut(s) 210
PspGI CCWGG 1 cut(s) 55
PspN4I GGNNCC 2 cut(s) 26, 27
PspOMI GGGCCC 1 cut(s) 25
PspPI GGNCC 3 cut(s) 25, 26, 92
Sau3AI GATC 1 cut(s) 102
Sau96I GGNCC 3 cut(s) 25, 26, 92
ScrFI CCNGG 4 cut(s) 57, 90, 95, 96
SduI GDGCHC 1 cut(s) 29
SetI ASST 1 cut(s) 35
SmaI CCCGGG 1 cut(s) 96
Sse9I AATT 1 cut(s) 77
SsiI CCGC 2 cut(s) 100, 146
SspMI CTAG 1 cut(s) 232
StyD4I CCNGG 4 cut(s) 55, 88, 93, 94
TaaI ACNGT 2 cut(s) 130, 172
TaiI ACGT 1 cut(s) 35
TasI AATT 1 cut(s) 77
TscAI CASTG 1 cut(s) 211
TseFI GTSAC 3 cut(s) 3, 81, 210
Tsp45I GTSAC 3 cut(s) 3, 81, 210
TspMI CCCGGG 1 cut(s) 94
TspRI CASTG 1 cut(s) 211
XmaI CCCGGG 1 cut(s) 94
XspI CTAG 1 cut(s) 232
ZraI GACGTC 1 cut(s) 33
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.