pycom13g27770

ribonuclease H protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
Physical Location & Seq
Forward (+)
23908152 .. 23911602
3451 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 2418 bp
ATGAACCCAAAAATCCACCCTTTGGATTTGGCCGAATTTCCCCATAAACATGCTACAACTTTTGAGATGGCAAATTTTCTAACAAAATTTACATTCAAAGAAGCAAAAAATAAAGCTTGTAACATTTACAACATTCAAATCATAAACTATAAAAATAAAAAACCCAAAAGGATTCACCAACTACTAGACCTAGTAAAGGCAGAATCATGCTTGTATGTAAAACAAAACTTTAACCATGAAATTCAAGGCCTAGTAGTTTTGAGAAACTTTTATACCTTTGAAGCACCTCTTTGCATAAGCAAAGTTTTTGGAGGAGGATGGTTGAATGGATTCTTTAAGTTCCCAAGAAAGGGAATCTCTAAGAGGATTGATACTAGTAAATCCCCTCTAAGGGGGCTGGCCTCCACGAGAGAAAAAGAGAGCTTTTGTTCTCTCCAATTTCCTCAAGAGAGAACCTTCATGAATTTTGAACCAAAAACTTTCATTCATGATATGGCCGGCCTTCTAAAGGCTTTGGGCTGTTCGGGCCCTTTTGAGTCTTTAGTCATTAAGTTGTCATACAACTTAAGTCCACTAATTACTCAAAAGCTAAAACGAACTTATTCTATCCTTACTCATCTCCGTTATTTCTTCAATCTCACGGTGTACGATAGGTTCCGTTTAGCGAGGCAGTGGGTGATTAGAAGTCATCAAATCAAATGTGAATTGAAACTTACTTTCAATTCTCCCTTTAGTGATTATACACCTTTAGGTAGAAGAGGTGGAGAACCTATTCAGTTTGGGATTACAATTGTTTGGTTTGATAGTTTATTCATGTCTACTCTCCAAGATTCTCTTACTTATATGATTACCTTGAACATGATTTGGAACAATTTCCTAAATCTCATTCTTTGGAACGACTTCCTAAATCTCATTTATATTTTGTGTTTGAAGGTTAGAGATTCCTTGTTGTGCATTCACTTGCCTCCATGGCTAAGTGGCTTAACCCCAACTATGTCGTGGATACCCTCTGACGATGACACCTCAGGTCAAATGACTACTTTGCATTATCCCAACCATGAGTTTTCATTGAGCACCTATATGCTTGTCTTGGTGTCAGTCACACCAATTACTCGAGACCAGTCACTCTCTCTAAGGGAAGACATAGCACGTACTGATCTTAACGGACTGTCAATGTATACGAAAGAGAATGGTCTCATGCATCTAATTTCTTTAGGTCATATTCTTCCAATTACATATTCCTTGGACTTACCATTTAAGCATATAACTAGTTTAATATGTGAAATGTTCGTAAAGTATCATCATATGATTGGGTTTAGGGCACATTTCCCAAAGATGGCCTTGAAGTTAGATATCAATAAGGCCTATAATTGTATTGAATCAAGTTTCTTGGAGCAAATTATGGAAAGGTTGTGTTTTACGGAGGAATGGATACACTGGATAATGATGTGCGTTTCTACAGTATCTTATTTGTTCAAACTGAATGGGGAACTTGTGGGGCTAGTATATCCGAAACGGGGAATTCATCAAGGCGATCGATTGTCACCATCCTTATTTGTTCTATGTGCAAAAGGCTTTTCGGTTCATGTATGTAAAGGAGGCCCAAGTTTTCATCATCTGCAATTAGTGGATGATAGCTTTATATTCGCCAGGAGTTATCTGCAAGAATATTTGCAGTTGAAGGAATTATTATCTACTTATGAACGGGCCTCTGGGCAAGTGGTCAACCTTTCTAAAAGTAGTGTTGCATTTAGTCAGAATCTCATGGAGATGGATTACCATGACCGGTATCTTGGCCTACAGGTGTTTATTGGTAGGTCCAAGAAAGATACATTTGCTTATATTAAAGATCGATTTGTGGAAAAAGTTGAATGGTTGGCGTGGATCGCAATGGCATTGTATACGATGCAAAGATTCTTGTTTCCTAAATCCTTTTGTGAAGAGCTAAACCAAATGGTGGTGCAATTTTGGTGGGGAAGGGAAGCAAGTAAACGGAGAATACATTGGGATTTATATGCATTCAAACTTGCTTTGCATGTGAAGCAAGGATGGAGACTATTACAGCATCCTAATTCTCTTGTTGCAAAAATTTTCAAAGCCTGGTATTACCCTACCACTGAGTTCTTTATTTGTCGAGGTGCGAAATGGAGGGTGGGGGCTTTACGAATTAACATTTGGGGGGATAGCTGGCTGCAATGGAAGCATTTCCATAAAGTTCTTAACCCCAGACCGATAGAGGTGCATCCAGAGCATTGTGGCAAGATCGTATACAAGGCTCCTATGAAAAGCATTGTGGCGAGCTCAAGTTCTGGGGAAAGTGAACATTTGTGTATGGCGTGGGTATGTGAATGCATTGCCTTCCAAAGTAAATTTGAAGAACAAACGCGTATTTACGAAGTATACTTGTGGTTTTTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

806

Amino Acids

94.24

Weight (kDa)

9.19

Isoelectric Point (pI)

43.64

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RVT_1 PF00078 445 - 591 1.1e-11 Reverse transcriptase (RNA-dependent DNA polymerase)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 22, 1957
AccI GTMKAC 5 cut(s) 818, 1178, 1901, 2268, 2400
AccII CGCG 1 cut(s) 2386
AclWI GGATC 1 cut(s) 1892
AcoI YGGCCR 2 cut(s) 30, 495
AcsI RAATTY 8 cut(s) 35, 73, 86, 240, 463, 1521, 2088, 2369
AfaI GTAC 2 cut(s) 647, 1153
AflII CTTAAG 1 cut(s) 565
AflIII ACRYGT 1 cut(s) 2384
AgeI ACCGGT 1 cut(s) 1785
AhlI ACTAGT 2 cut(s) 374, 1268
AjnI CCWGG 2 cut(s) 1649, 2099
AjuI GAANNNNNNNTTGG 4 cut(s) 1222, 1254, 2158, 2190
AluBI AGCT 7 cut(s) 116, 423, 589, 1638, 1945, 2187, 2301
AluI AGCT 7 cut(s) 116, 423, 589, 1638, 1945, 2187, 2301
Alw21I GWGCWC 2 cut(s) 1076, 2303
Alw26I GTCTC 3 cut(s) 1110, 1199, 2047
AlwI GGATC 1 cut(s) 1892
Ama87I CYCGRG 1 cut(s) 1113
ApaI GGGCCC 1 cut(s) 530
ApeKI GCWGC 1 cut(s) 2191
ApoI RAATTY 8 cut(s) 35, 73, 86, 240, 463, 1521, 2088, 2369
AsiGI ACCGGT 1 cut(s) 1785
Asp700I GAANNNNTTC 6 cut(s) 329, 601, 771, 872, 899, 2204
AspS9I GGNCC 5 cut(s) 526, 527, 1601, 1707, 1818
AsuHPI GGTGA 3 cut(s) 167, 688, 1536
AvaI CYCGRG 1 cut(s) 1113
AvaII GGWCC 1 cut(s) 1818
AxyI CCTNAGG 1 cut(s) 1024
BaeGI GKGCMC 2 cut(s) 530, 1324
BanII GRGCYC 2 cut(s) 530, 2303
BauI CACGAG 1 cut(s) 406
BbsI GAAGAC 1 cut(s) 1146
Bbv12I GWGCWC 2 cut(s) 1076, 2303
BbvI GCAGC 1 cut(s) 2178
BccI CCATC 6 cut(s) 61, 312, 1330, 1555, 1765, 2043
BcgI CGANNNNNNTGC 2 cut(s) 2221, 2255
BciT130I CCWGG 2 cut(s) 1651, 2101
BciVI GTATCC 2 cut(s) 996, 1425
BcoDI GTCTC 3 cut(s) 1110, 1199, 2047
BcuI ACTAGT 2 cut(s) 374, 1268
BfaI CTAG 6 cut(s) 185, 191, 251, 375, 1269, 1502
BfmI CTRYAG 2 cut(s) 1458, 1799
BfrI CTTAAG 1 cut(s) 565
BfuI GTATCC 2 cut(s) 996, 1425
BglI GCCNNNNNGGC 1 cut(s) 970
BisI GCNGC 1 cut(s) 2192
BlsI GCNGC 1 cut(s) 2193
Bme1390I CCNGG 2 cut(s) 1651, 2101
Bme18I GGWCC 1 cut(s) 1818
BmeT110I CYCGRG 1 cut(s) 1113
BmgT120I GGNCC 5 cut(s) 526, 527, 1601, 1707, 1818
BmiI GGNNCC 3 cut(s) 528, 656, 2277
BmrFI CCNGG 2 cut(s) 1651, 2101
BmsI GCATC 4 cut(s) 1210, 1896, 2074, 2251
BpiI GAAGAC 1 cut(s) 1146
BpuEI CTTGAG 2 cut(s) 429, 2287
Bsa29I ATCGAT 2 cut(s) 1537, 1852
BsaAI YACGTR 1 cut(s) 1151
BsaI GGTCTC 2 cut(s) 1110, 1199
BsaJI CCNNGG 2 cut(s) 968, 1242
BsaWI WCCGGW 1 cut(s) 1785
Bse118I RCCGGY 2 cut(s) 497, 1785
Bse1I ACTGG 2 cut(s) 1120, 1442
Bse21I CCTNAGG 1 cut(s) 1024
Bse3DI GCAATG 3 cut(s) 1896, 2201, 2352
BseBI CCWGG 2 cut(s) 1651, 2101
BseCI ATCGAT 2 cut(s) 1537, 1852
BseDI CCNNGG 2 cut(s) 968, 1242
BseGI GGATG 6 cut(s) 323, 1547, 1636, 2054, 2065, 2242
BseMI GCAATG 3 cut(s) 1896, 2201, 2352
BseMII CTCAG 2 cut(s) 1038, 2109
BseNI ACTGG 2 cut(s) 1120, 1442
BseRI GAGGAG 1 cut(s) 327
BseSI GKGCMC 2 cut(s) 530, 1324
BseXI GCAGC 1 cut(s) 2178
Bsh1236I CGCG 1 cut(s) 2386
Bsh1285I CGRYCG 1 cut(s) 1537
BshTI ACCGGT 1 cut(s) 1785
BshVI ATCGAT 2 cut(s) 1537, 1852
BsiEI CGRYCG 1 cut(s) 1537
BsiHKAI GWGCWC 2 cut(s) 1076, 2303
BsiHKCI CYCGRG 1 cut(s) 1113
BsiSI CCGG 2 cut(s) 498, 1786
BsmAI GTCTC 3 cut(s) 1110, 1199, 2047
BsmI GAATGC 3 cut(s) 954, 2018, 2354
Bso31I GGTCTC 2 cut(s) 1110, 1199
BsoBI CYCGRG 1 cut(s) 1113
Bsp120I GGGCCC 1 cut(s) 526
Bsp1286I GDGCHC 4 cut(s) 530, 1076, 1324, 2303
Bsp143I GATC 5 cut(s) 1156, 1534, 1849, 1884, 2262
Bsp19I CCATGG 1 cut(s) 968
BspCNI CTCAG 2 cut(s) 1037, 2110
BspDI ATCGAT 2 cut(s) 1537, 1852
BspFNI CGCG 1 cut(s) 2386
BspHI TCATGA 2 cut(s) 459, 487
BspLI GGNNCC 3 cut(s) 528, 656, 2277
BspPI GGATC 1 cut(s) 1892
BspQI GCTCTTC 1 cut(s) 1935
BspTI CTTAAG 1 cut(s) 565
BspTNI GGTCTC 2 cut(s) 1110, 1199
BsrDI GCAATG 3 cut(s) 1896, 2201, 2352
BsrFI RCCGGY 2 cut(s) 497, 1785
BsrI ACTGG 2 cut(s) 1120, 1442
BssAI RCCGGY 2 cut(s) 497, 1785
BssECI CCNNGG 2 cut(s) 968, 1242
BssMI GATC 5 cut(s) 1156, 1534, 1849, 1884, 2262
BssNAI GTATAC 4 cut(s) 1179, 1902, 2269, 2401
BssSI CACGAG 1 cut(s) 406
BssT1I CCWWGG 2 cut(s) 968, 1242
Bst1107I GTATAC 4 cut(s) 1179, 1902, 2269, 2401
Bst2BI CACGAG 1 cut(s) 406
Bst2UI CCWGG 2 cut(s) 1651, 2101
Bst4CI ACNGT 3 cut(s) 643, 1170, 1462
Bst6I CTCTTC 2 cut(s) 751, 1935
BstAFI CTTAAG 1 cut(s) 565
BstBAI YACGTR 1 cut(s) 1151
BstC8I GCNNGC 4 cut(s) 399, 499, 2189, 2299
BstDEI CTNAG 6 cut(s) 360, 389, 974, 1024, 1133, 2118
BstDSI CCRYGG 1 cut(s) 968
BstENI CCTNNNNNAGG 2 cut(s) 194, 506
BstF5I GGATG 6 cut(s) 323, 1547, 1636, 2054, 2065, 2242
BstFNI CGCG 1 cut(s) 2386
BstKTI GATC 5 cut(s) 1159, 1537, 1852, 1887, 2265
BstMAI GTCTC 3 cut(s) 1110, 1199, 2047
BstMBI GATC 5 cut(s) 1156, 1534, 1849, 1884, 2262
BstMCI CGRYCG 1 cut(s) 1537
BstMWI GCNNNNNNNGC 6 cut(s) 525, 970, 1886, 2041, 2200, 2248
BstNI CCWGG 2 cut(s) 1651, 2101
BstNSI RCATGY 2 cut(s) 53, 2039
BstSCI CCNGG 2 cut(s) 1649, 2099
BstSFI CTRYAG 2 cut(s) 1458, 1799
BstSLI GKGCMC 2 cut(s) 530, 1324
BstUI CGCG 1 cut(s) 2386
BstV1I GCAGC 1 cut(s) 2178
BstV2I GAAGAC 1 cut(s) 1146
BstZ17I GTATAC 4 cut(s) 1179, 1902, 2269, 2401
Bsu15I ATCGAT 2 cut(s) 1537, 1852
Bsu36I CCTNAGG 1 cut(s) 1024
BsuI GTATCC 2 cut(s) 996, 1425
BsuTUI ATCGAT 2 cut(s) 1537, 1852
BtgI CCRYGG 1 cut(s) 968
BtsCI GGATG 6 cut(s) 323, 1547, 1636, 2054, 2065, 2242
BtsI GCAGTG 1 cut(s) 677
BtsIMutI CAGTG 3 cut(s) 677, 1435, 2115
Cac8I GCNNGC 4 cut(s) 399, 499, 2189, 2299
CciI TCATGA 2 cut(s) 459, 487
Cfr10I RCCGGY 2 cut(s) 497, 1785
Cfr13I GGNCC 5 cut(s) 526, 527, 1601, 1707, 1818
ClaI ATCGAT 2 cut(s) 1537, 1852
Csp6I GTAC 2 cut(s) 646, 1152
CspAI ACCGGT 1 cut(s) 1785
CspCI CAANNNNNGTGG 2 cut(s) 1952, 1987
CviQI GTAC 2 cut(s) 646, 1152
DdeI CTNAG 6 cut(s) 360, 389, 974, 1024, 1133, 2118
DpnI GATC 5 cut(s) 1158, 1536, 1851, 1886, 2264
DpnII GATC 5 cut(s) 1156, 1534, 1849, 1884, 2262
EaeI YGGCCR 2 cut(s) 30, 495
Eam1104I CTCTTC 2 cut(s) 751, 1935
EarI CTCTTC 2 cut(s) 751, 1935
Ecl136II GAGCTC 1 cut(s) 2301
Eco130I CCWWGG 2 cut(s) 968, 1242
Eco147I AGGCCT 2 cut(s) 249, 1364
Eco24I GRGCYC 2 cut(s) 530, 2303
Eco31I GGTCTC 2 cut(s) 1110, 1199
Eco32I GATATC 1 cut(s) 1354
Eco47I GGWCC 1 cut(s) 1818
Eco53kI GAGCTC 1 cut(s) 2301
Eco81I CCTNAGG 1 cut(s) 1024
Eco88I CYCGRG 1 cut(s) 1113
EcoICRI GAGCTC 1 cut(s) 2301
EcoNI CCTNNNNNAGG 2 cut(s) 194, 506
EcoO109I RGGNCCY 1 cut(s) 527
EcoRI GAATTC 1 cut(s) 1521
EcoRII CCWGG 2 cut(s) 1649, 2099
EcoRV GATATC 1 cut(s) 1354
EcoT14I CCWWGG 2 cut(s) 968, 1242
EcoT22I ATGCAT 3 cut(s) 1203, 2020, 2354
EcoT38I GRGCYC 2 cut(s) 530, 2303
ErhI CCWWGG 2 cut(s) 968, 1242
FalI AAGNNNNNCTT 6 cut(s) 273, 305, 819, 851, 1325, 1357
FauNDI CATATG 1 cut(s) 1305
FblI GTMKAC 5 cut(s) 818, 1178, 1901, 2268, 2400
Fnu4HI GCNGC 1 cut(s) 2192
FokI GGATG 6 cut(s) 330, 1534, 1643, 2052, 2061, 2229
FriOI GRGCYC 2 cut(s) 530, 2303
FseI GGCCGGCC 1 cut(s) 501
Fsp4HI GCNGC 1 cut(s) 2192
FspBI CTAG 6 cut(s) 185, 191, 251, 375, 1269, 1502
GluI GCNGC 1 cut(s) 2192
HapII CCGG 2 cut(s) 498, 1786
HincII GTYRAC 1 cut(s) 1726
HindII GTYRAC 1 cut(s) 1726
HindIII AAGCTT 1 cut(s) 114
HpaII CCGG 2 cut(s) 498, 1786
HphI GGTGA 3 cut(s) 167, 688, 1536
Hpy188I TCNGA 3 cut(s) 1012, 1512, 1758
Hpy188III TCNNGA 5 cut(s) 446, 460, 488, 1115, 2246
HpyAV CCTTC 6 cut(s) 466, 512, 925, 1675, 1971, 2368
HpyCH4III ACNGT 3 cut(s) 643, 1170, 1462
HpyCH4IV ACGT 1 cut(s) 1150
HpyF10VI GCNNNNNNNGC 6 cut(s) 525, 970, 1886, 2041, 2200, 2248
HpyF3I CTNAG 6 cut(s) 360, 389, 974, 1024, 1133, 2118
HpySE526I ACGT 1 cut(s) 1150
KroI GCCGGC 1 cut(s) 497
KroNI GCCGGC 1 cut(s) 499
Kzo9I GATC 5 cut(s) 1156, 1534, 1849, 1884, 2262
LguI GCTCTTC 1 cut(s) 1935
LmnI GCTCC 2 cut(s) 1393, 2281
Lsp1109I GCAGC 1 cut(s) 2178
LweI GCATC 4 cut(s) 1210, 1896, 2074, 2251
MaeI CTAG 6 cut(s) 185, 191, 251, 375, 1269, 1502
MaeII ACGT 1 cut(s) 1150
MaeIII GTNAC 4 cut(s) 119, 1099, 1122, 1542
MalI GATC 5 cut(s) 1158, 1536, 1851, 1886, 2264
MboI GATC 5 cut(s) 1156, 1534, 1849, 1884, 2262
MboII GAAGA 6 cut(s) 622, 768, 1151, 1217, 1952, 2387
MfeI CAATTG 1 cut(s) 789
MhlI GDGCHC 4 cut(s) 530, 1076, 1324, 2303
MluI ACGCGT 1 cut(s) 2384
MlyI GAGTC 1 cut(s) 545
Mph1103I ATGCAT 3 cut(s) 1203, 2020, 2354
MroNI GCCGGC 1 cut(s) 497
MroXI GAANNNNTTC 6 cut(s) 329, 601, 771, 872, 899, 2204
MslI CAYNNNNRTG 3 cut(s) 48, 1079, 1769
MspCI CTTAAG 1 cut(s) 565
MspI CCGG 2 cut(s) 498, 1786
MspR9I CCNGG 2 cut(s) 1651, 2101
MunI CAATTG 1 cut(s) 789
Mva1269I GAATGC 3 cut(s) 954, 2018, 2354
MvaI CCWGG 2 cut(s) 1651, 2101
MvnI CGCG 1 cut(s) 2386
MwoI GCNNNNNNNGC 6 cut(s) 525, 970, 1886, 2041, 2200, 2248
NaeI GCCGGC 1 cut(s) 499
NcoI CCATGG 1 cut(s) 968
NdeI CATATG 1 cut(s) 1305
NdeII GATC 5 cut(s) 1156, 1534, 1849, 1884, 2262
NgoMIV GCCGGC 1 cut(s) 497
NlaIV GGNNCC 3 cut(s) 528, 656, 2277
NmuCI GTSAC 3 cut(s) 1099, 1122, 1542
NsiI ATGCAT 3 cut(s) 1203, 2020, 2354
NspI RCATGY 2 cut(s) 53, 2039
PaeR7I CTCGAG 1 cut(s) 1113
PagI TCATGA 2 cut(s) 459, 487
PceI AGGCCT 2 cut(s) 249, 1364
PciSI GCTCTTC 1 cut(s) 1935
PctI GAATGC 3 cut(s) 954, 2018, 2354
PdiI GCCGGC 1 cut(s) 499
PdmI GAANNNNTTC 6 cut(s) 329, 601, 771, 872, 899, 2204
PfeI GAWTC 9 cut(s) 172, 203, 330, 354, 830, 941, 1379, 1759, 1914
PflMI CCANNNNNTGG 2 cut(s) 22, 1957
PinAI ACCGGT 1 cut(s) 1785
PkrI GCNGC 1 cut(s) 2193
Ple19I CGATCG 1 cut(s) 1537
PleI GAGTC 1 cut(s) 544
PpsI GAGTC 1 cut(s) 544
Ppu21I YACGTR 1 cut(s) 1151
Psp124BI GAGCTC 1 cut(s) 2303
Psp6I CCWGG 2 cut(s) 1649, 2099
PspGI CCWGG 2 cut(s) 1649, 2099
PspN4I GGNNCC 3 cut(s) 528, 656, 2277
PspOMI GGGCCC 1 cut(s) 526
PspPI GGNCC 5 cut(s) 526, 527, 1601, 1707, 1818
PsrI GAACNNNNNNTAC 2 cut(s) 638, 670
PvuI CGATCG 1 cut(s) 1537
RigI GGCCGGCC 1 cut(s) 501
RsaI GTAC 2 cut(s) 647, 1153
RsaNI GTAC 2 cut(s) 646, 1152
RseI CAYNNNNRTG 3 cut(s) 48, 1079, 1769
SacI GAGCTC 1 cut(s) 2303
SapI GCTCTTC 1 cut(s) 1935
SatI GCNGC 1 cut(s) 2192
Sau3AI GATC 5 cut(s) 1156, 1534, 1849, 1884, 2262
Sau96I GGNCC 5 cut(s) 526, 527, 1601, 1707, 1818
SchI GAGTC 1 cut(s) 545
ScrFI CCNGG 2 cut(s) 1651, 2101
SduI GDGCHC 4 cut(s) 530, 1076, 1324, 2303
SfaNI GCATC 4 cut(s) 1210, 1896, 2074, 2251
SfcI CTRYAG 2 cut(s) 1458, 1799
Sfr274I CTCGAG 1 cut(s) 1113
SinI GGWCC 1 cut(s) 1818
SlaI CTCGAG 1 cut(s) 1113
SmiMI CAYNNNNRTG 3 cut(s) 48, 1079, 1769
SmlI CTYRAG 4 cut(s) 444, 565, 1113, 2302
SmoI CTYRAG 4 cut(s) 444, 565, 1113, 2302
SpeI ACTAGT 2 cut(s) 374, 1268
SseBI AGGCCT 2 cut(s) 249, 1364
SspI AATATT 1 cut(s) 1670
SspMI CTAG 6 cut(s) 185, 191, 251, 375, 1269, 1502
SstI GAGCTC 1 cut(s) 2303
StuI AGGCCT 2 cut(s) 249, 1364
StyD4I CCNGG 2 cut(s) 1649, 2099
StyI CCWWGG 2 cut(s) 968, 1242
TaaI ACNGT 3 cut(s) 643, 1170, 1462
TaiI ACGT 1 cut(s) 1153
TaqI TCGA 4 cut(s) 1114, 1537, 1852, 2134
TaqII GACCGA 1 cut(s) 2245
TfiI GAWTC 9 cut(s) 172, 203, 330, 354, 830, 941, 1379, 1759, 1914
TscAI CASTG 3 cut(s) 677, 1442, 2122
TseFI GTSAC 3 cut(s) 1099, 1122, 1542
TseI GCWGC 1 cut(s) 2191
Tsp45I GTSAC 3 cut(s) 1099, 1122, 1542
TspGWI ACGGA 5 cut(s) 611, 647, 1179, 1436, 2008
TspRI CASTG 3 cut(s) 677, 1442, 2122
Van91I CCANNNNNTGG 2 cut(s) 22, 1957
Vha464I CTTAAG 1 cut(s) 565
VpaK11BI GGWCC 1 cut(s) 1818
XagI CCTNNNNNAGG 2 cut(s) 194, 506
XapI RAATTY 8 cut(s) 35, 73, 86, 240, 463, 1521, 2088, 2369
XceI RCATGY 2 cut(s) 53, 2039
XcmI CCANNNNNNNNNTGG 1 cut(s) 996
XhoI CTCGAG 1 cut(s) 1113
XmiI GTMKAC 5 cut(s) 818, 1178, 1901, 2268, 2400
XmnI GAANNNNTTC 6 cut(s) 329, 601, 771, 872, 899, 2204
XspI CTAG 6 cut(s) 185, 191, 251, 375, 1269, 1502
Zsp2I ATGCAT 3 cut(s) 1203, 2020, 2354
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.