pycom17g17020

respiratory chain complex III assembly

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
Physical Location & Seq
Forward (+)
14914975 .. 14916423
1449 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 912 bp
ATGAAAAAGATAAACTTGTATAGTCTTTTACTTTCAACAAATGGATGTATTCCGGCAATAATAGGGTTTGCTCGAAATGGAAAGTGTATTTTCCTATTATTGATTAGTGGAGATTGGTCAAATCATAGGATAACATTAGAAATTTTCTCAATACCAATTAACTCATTGACCAAATTAATTGATTCTAGAGGAATTTTACTCCATTTTCTACATCGGTTTCAATATGGTAATGTGAATATGCTATTTTTTTTTTCAATTTTTTTTGCAATCGACGGTTTCATCGTTGCGCAAAATTGTAGGATGAAAAGGATAAATAAGAATGTCCAAATGAGAAGGTTGTTAACATTTTCATTAGAAAAATGCAAAATCATTAGATCCTCTACATGGTCCCGGTCCGAAGCCTACAACAATAAATACCAACATAAGATGCCAAAAATTTTCCAAATCAAGGGTATAATATGCACATACACTGACCAAATAAAGTACAACTGTCAAATGTATTATATGCACATACACAAGCATATGTTATATAACCAGCGCGGTGTTGGCAGATTGGGTTGCAAAGCTTATTTGCGACTTTTGGGCTGGAAGATGATGGATTTTGGACTTGGGCTCTTCTTAGAACTTAACAAGGAGGTCCTAATCCTCCATAAACGTGGCTATTTCTCTGCTGGACAGATTTCCTTATTAGATTTGTATTGTGTTTTTAAGTTATCCTTTTACTATTATATTTCCTATAGGGTTCTCGGCGTGACATTGAGAGAACTTAGCAAAGCTTTGCAGAATTTCAGACTTCTTACTTACAATGTGTTTTCAATCCTTTTTCTAATTAATGATATTTTCTTTAGTTTTTATTATGATTATTTTATTAATTTACTTATGAATGGATGCATGCTTGCTTTGAATAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

304

Amino Acids

35.81

Weight (kDa)

9.74

Isoelectric Point (pI)

35.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 288
AccII CGCG 1 cut(s) 540
AciI CCGC 1 cut(s) 540
AclWI GGATC 1 cut(s) 369
AcsI RAATTY 4 cut(s) 141, 192, 435, 784
AfaI GTAC 1 cut(s) 485
AfiI CCNNNNNNNGG 2 cut(s) 384, 448
AgsI TTSAA 5 cut(s) 36, 221, 255, 816, 904
AluBI AGCT 2 cut(s) 566, 776
AluI AGCT 2 cut(s) 566, 776
AlwI GGATC 1 cut(s) 369
ApoI RAATTY 4 cut(s) 141, 192, 435, 784
AseI ATTAAT 3 cut(s) 176, 831, 870
AspLEI GCGC 2 cut(s) 289, 540
AspS9I GGNCC 3 cut(s) 387, 393, 637
AsuC2I CCSGG 1 cut(s) 391
AvaII GGWCC 3 cut(s) 387, 393, 637
BanII GRGCYC 1 cut(s) 615
BccI CCATC 1 cut(s) 589
BcnI CCSGG 1 cut(s) 391
BfaI CTAG 1 cut(s) 186
BfmI CTRYAG 1 cut(s) 736
Bme1390I CCNGG 1 cut(s) 391
Bme18I GGWCC 3 cut(s) 387, 393, 637
BmgT120I GGNCC 3 cut(s) 387, 393, 637
BmiI GGNNCC 1 cut(s) 389
BmrFI CCNGG 1 cut(s) 391
BmsI GCATC 2 cut(s) 417, 878
BpuMI CCSGG 1 cut(s) 391
Bsc4I CCNNNNNNNGG 2 cut(s) 384, 448
BseGI GGATG 3 cut(s) 50, 306, 893
BseLI CCNNNNNNNGG 2 cut(s) 384, 448
Bsh1236I CGCG 1 cut(s) 540
BsiSI CCGG 2 cut(s) 53, 391
BslFI GGGAC 1 cut(s) 373
BslI CCNNNNNNNGG 2 cut(s) 384, 448
BsmFI GGGAC 1 cut(s) 373
Bsp1286I GDGCHC 1 cut(s) 615
Bsp143I GATC 1 cut(s) 374
BspACI CCGC 1 cut(s) 540
BspFNI CGCG 1 cut(s) 540
BspLI GGNNCC 1 cut(s) 389
BspPI GGATC 1 cut(s) 369
BspQI GCTCTTC 1 cut(s) 620
BssMI GATC 1 cut(s) 374
Bst4CI ACNGT 2 cut(s) 275, 491
Bst6I CTCTTC 1 cut(s) 620
BstC8I GCNNGC 2 cut(s) 893, 897
BstDEI CTNAG 2 cut(s) 619, 767
BstF5I GGATG 3 cut(s) 50, 306, 893
BstFNI CGCG 1 cut(s) 540
BstHHI GCGC 2 cut(s) 289, 540
BstKTI GATC 1 cut(s) 377
BstMBI GATC 1 cut(s) 374
BstMWI GCNNNNNNNGC 1 cut(s) 546
BstNSI RCATGY 1 cut(s) 895
BstSCI CCNGG 1 cut(s) 389
BstSFI CTRYAG 1 cut(s) 736
BstUI CGCG 1 cut(s) 540
BstX2I RGATCY 1 cut(s) 374
BstXI CCANNNNNNTGG 1 cut(s) 656
BstYI RGATCY 1 cut(s) 374
BtsCI GGATG 3 cut(s) 50, 306, 893
BtsIMutI CAGTG 1 cut(s) 468
Cac8I GCNNGC 2 cut(s) 893, 897
CfoI GCGC 2 cut(s) 289, 540
Cfr13I GGNCC 3 cut(s) 387, 393, 637
CpoI CGGWCCG 1 cut(s) 393
Csp6I GTAC 1 cut(s) 484
CspI CGGWCCG 1 cut(s) 393
CviAII CATG 2 cut(s) 384, 892
CviJI RGCY 6 cut(s) 401, 566, 585, 613, 660, 776
CviKI_1 RGCY 6 cut(s) 401, 566, 585, 613, 660, 776
CviQI GTAC 1 cut(s) 484
DdeI CTNAG 2 cut(s) 619, 767
DpnI GATC 1 cut(s) 376
DpnII GATC 1 cut(s) 374
Eam1104I CTCTTC 1 cut(s) 620
EarI CTCTTC 1 cut(s) 620
Eco24I GRGCYC 1 cut(s) 615
Eco47I GGWCC 3 cut(s) 387, 393, 637
EcoO109I RGGNCCY 1 cut(s) 637
EcoT22I ATGCAT 1 cut(s) 893
EcoT38I GRGCYC 1 cut(s) 615
FaeI CATG 2 cut(s) 387, 895
FalI AAGNNNNNCTT 3 cut(s) 31, 701, 733
FaqI GGGAC 1 cut(s) 373
FatI CATG 2 cut(s) 383, 891
FauNDI CATATG 1 cut(s) 522
FokI GGATG 3 cut(s) 57, 313, 900
FriOI GRGCYC 1 cut(s) 615
FspBI CTAG 1 cut(s) 186
FspI TGCGCA 1 cut(s) 288
GlaI GCGC 2 cut(s) 288, 539
HapII CCGG 2 cut(s) 53, 391
HhaI GCGC 2 cut(s) 289, 540
Hin1II CATG 2 cut(s) 387, 895
Hin6I GCGC 2 cut(s) 287, 538
HinP1I GCGC 2 cut(s) 287, 538
HincII GTYRAC 1 cut(s) 342
HindII GTYRAC 1 cut(s) 342
HindIII AAGCTT 2 cut(s) 564, 774
HinfI GANTC 1 cut(s) 182
HpaI GTTAAC 1 cut(s) 342
HpaII CCGG 2 cut(s) 53, 391
Hpy166II GTNNAC 1 cut(s) 342
Hpy188I TCNGA 2 cut(s) 397, 791
Hpy188III TCNNGA 1 cut(s) 186
Hpy8I GTNNAC 1 cut(s) 342
Hpy99I CGWCG 1 cut(s) 275
HpyAV CCTTC 1 cut(s) 327
HpyCH4III ACNGT 2 cut(s) 275, 491
HpyCH4IV ACGT 1 cut(s) 655
HpyCH4V TGCA 7 cut(s) 266, 363, 462, 508, 561, 781, 891
HpyF10VI GCNNNNNNNGC 1 cut(s) 546
HpyF3I CTNAG 2 cut(s) 619, 767
HpySE526I ACGT 1 cut(s) 655
Hsp92II CATG 2 cut(s) 387, 895
HspAI GCGC 2 cut(s) 287, 538
KspAI GTTAAC 1 cut(s) 342
Kzo9I GATC 1 cut(s) 374
LguI GCTCTTC 1 cut(s) 620
LpnPI CCDG 5 cut(s) 66, 404, 548, 571, 657
LweI GCATC 2 cut(s) 417, 878
MaeI CTAG 1 cut(s) 186
MaeII ACGT 1 cut(s) 655
MaeIII GTNAC 1 cut(s) 751
MalI GATC 1 cut(s) 376
MboI GATC 1 cut(s) 374
MboII GAAGA 2 cut(s) 601, 607
MflI RGATCY 1 cut(s) 374
MhlI GDGCHC 1 cut(s) 615
MnlI CCTC 4 cut(s) 182, 388, 628, 656
Mph1103I ATGCAT 1 cut(s) 893
MseI TTAA 8 cut(s) 159, 176, 341, 627, 708, 831, 870, 910
MslI CAYNNNNRTG 1 cut(s) 654
MspI CCGG 2 cut(s) 53, 391
MspR9I CCNGG 1 cut(s) 391
MvnI CGCG 1 cut(s) 540
MwoI GCNNNNNNNGC 1 cut(s) 546
NciI CCSGG 1 cut(s) 391
NdeI CATATG 1 cut(s) 522
NdeII GATC 1 cut(s) 374
NlaIII CATG 2 cut(s) 387, 895
NlaIV GGNNCC 1 cut(s) 389
NmeAIII GCCGAG 1 cut(s) 726
NmuCI GTSAC 1 cut(s) 751
NsbI TGCGCA 1 cut(s) 288
NsiI ATGCAT 1 cut(s) 893
NspI RCATGY 1 cut(s) 895
PaeI GCATGC 1 cut(s) 895
PciSI GCTCTTC 1 cut(s) 620
PcsI WCGNNNNNNNCGW 1 cut(s) 279
PfeI GAWTC 1 cut(s) 182
PpuMI RGGWCCY 1 cut(s) 637
PshBI ATTAAT 3 cut(s) 176, 831, 870
Psp5II RGGWCCY 1 cut(s) 637
PspN4I GGNNCC 1 cut(s) 389
PspPI GGNCC 3 cut(s) 387, 393, 637
PspPPI RGGWCCY 1 cut(s) 637
PsuI RGATCY 1 cut(s) 374
RsaI GTAC 1 cut(s) 485
RsaNI GTAC 1 cut(s) 484
RseI CAYNNNNRTG 1 cut(s) 654
Rsr2I CGGWCCG 1 cut(s) 393
RsrII CGGWCCG 1 cut(s) 393
SapI GCTCTTC 1 cut(s) 620
SaqAI TTAA 8 cut(s) 159, 176, 341, 627, 708, 831, 870, 910
Sau3AI GATC 1 cut(s) 374
Sau96I GGNCC 3 cut(s) 387, 393, 637
ScrFI CCNGG 1 cut(s) 391
SduI GDGCHC 1 cut(s) 615
SetI ASST 5 cut(s) 338, 568, 639, 658, 778
SfaNI GCATC 2 cut(s) 417, 878
SfcI CTRYAG 1 cut(s) 736
SinI GGWCC 3 cut(s) 387, 393, 637
SmiMI CAYNNNNRTG 1 cut(s) 654
SphI GCATGC 1 cut(s) 895
SsiI CCGC 1 cut(s) 540
SspMI CTAG 1 cut(s) 186
StyD4I CCNGG 1 cut(s) 389
TaaI ACNGT 2 cut(s) 275, 491
TaiI ACGT 1 cut(s) 658
TaqI TCGA 2 cut(s) 73, 270
TatI WGTACW 1 cut(s) 483
TfiI GAWTC 1 cut(s) 182
Tru1I TTAA 8 cut(s) 159, 176, 341, 627, 708, 831, 870, 910
Tru9I TTAA 8 cut(s) 159, 176, 341, 627, 708, 831, 870, 910
TscAI CASTG 1 cut(s) 475
TseFI GTSAC 1 cut(s) 751
Tsp45I GTSAC 1 cut(s) 751
TspDTI ATGAA 5 cut(s) 17, 268, 317, 339, 896
TspRI CASTG 1 cut(s) 475
VpaK11BI GGWCC 3 cut(s) 387, 393, 637
VspI ATTAAT 3 cut(s) 176, 831, 870
XapI RAATTY 4 cut(s) 141, 192, 435, 784
XbaI TCTAGA 1 cut(s) 185
XceI RCATGY 1 cut(s) 895
XcmI CCANNNNNNNNNTGG 1 cut(s) 542
XspI CTAG 1 cut(s) 186
Zsp2I ATGCAT 1 cut(s) 893
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.