Rmu_sc0002551.1_g000010

resistance protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002551.1
Physical Location & Seq
Forward (+)
46523 .. 56576
10054 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002551.1_g000010.1.cds

Sequence Viewer

Length: 5436 bp
atgcctccccaggcctccatgttcatggaggaaaattcagagacagaccgcgaaggcagccgctctctagtctggcagaatgctagcccccgcgcttctgctccacacctccaccggagctccccagagccaccgcaactccatgcctcctccgtgcctctattcttggactcttgggttgccctgcccccgctgttggctgacaaacgctcgacctgccagccgtcgcgtcccttgttccaccaccaatctcaaatagctattccaccactcgatcctccaatggcggcgcttccaccccccaaaactttgatggcatcgaaattcaaaaccctactgcaaagaaaaagacatgaccaggcaactgccaccacagttggcccccacctcacatcgcatgcctcccaaggcctccatgttcatggaggaaaattcagagacggaccgcgaaggcagccgctctctagtctagcagaatttaccaccaatacagatataattccttcttcttcttcttcttcttcgtcgtcgttttcttctccaccatccggtaaactcacgtacgatgtgttccttagtttcagaggtacagatacccgcaaaaatttcacggaccatctttatactgctctcaaacagaaaggtatattcacttttagagacgatgaagaactcgagaggggggaatcgattggtccaaatctcttgaaagcaatcgaagaatcaagatatgtaattgctgttttctcacgaaactacgccgattctgcatggtgtttggatgagattgccaagatcgccgattgcatgaaagccatgggacaaaaagtcctcccagtgttctaccatgttgatccatctgaggtacgaagacaaacaggggatcactttgggaaagcatttgagaagcatcagaggcggtataaagccgaaccagacaaagtaaagaggtggaaggacgctctttttcaagtaggcaatctctctggatggcatctgcaagatgggtacgaatccaaagttattcaagaaattgttgaaaagattttcaccgagttaaatcaaataatctcaatatccgagggtttagttggcatggattctcacctgaatgaaatgctttcatacttggacattgggtgtccggatgttcgtatcatagggatttgtgggatgggtggtatcggtaagacaactattgcacaagtggtttttgaaagggtacaagctcagtttgatggttgcagctttcttgagaatgttagagaggtaattgaaaagcaaggtgcagtgcatttacaagagcaacttctttcgaatttgctgagatttagtgtaaatgtacagaacactaaaatgggaaaaaatataatgaggcagaggctatgtactaaaatggttcttctcattcttgatgatgtggaccaagaagaacaattggaagcattgtgtgatagggaatcgtttggtccagggagtaggatcatcataacttctagagatgaacatttgctcagtgcagttgaaggagataaagtatataaggtgaatccattaactgatgctgaagctcttcagcttttcagtatgaaagcctttaagaaagaccagctggttggagaagaaattctgaagctatccaaagagtttttgaaatatgctaatggccttccactagctattaaagttttgggttcttctgttaagggtagaagtgtagacttatggttaagtgcattggatagacttaaagaaaatcctgaaaaaaaaattattaatgttctcaaagttagttttgatggattagaaccaagagaaaagaagatttttttggacattgcatgtttctttaaaggggagagcatagatcgtgtaagaagaatattacaaggtagtgatgcccactgtccggactttgatgtacaagttctcctggacaaatctatgataactgtatttggaaaaagattgtggatgcatgatttgatacaacagttaggttgggaagttgtccgtcaagaatgtcctgaagagcctggaaaacgtagtcgattgtggcttccaaatgagatcattgatgttcttgatcagaataaggcaaccactgcagttcaaagcatactcctccaacgtcgaacaaaagacgatgtggttcactcagttaatgactcattcacaaatatggacagactaagattgctcaaaatttggaatgtgaagtttgctggaaacatcaattatctttctaagaagttacagtttctggaatgggacgaatgtcctttagactctttcccgtcagactttcaaccggataaccttgttgaacttcagatgcattcaagctgcctcaaacaattatggagaggaaaaaaaggatggagaatgctacggcttattgatatgagtagttcagaatacttgatgtcgactccagatttcactgaggttccatttcttgagatattggtgcttcaagattgtacaaggttggttgaggttcacccttctcttggagtcctcaagaaacttgtctctttaaatatgagaaattgcaagtcagttgagagcattccacctttcattagtttggagtcccttaaaactttgaatctttcactctgttcaaaactcaagaagtttcctgaaattgaaggaaatatgaaaagcttgctggagcttcatttagatgggactagtattgaggaattgcctctatcagttgaaggtttgactggtctgaccacattaaatttaacagattgtaacaaccttttgcgtctccccagtaccattcagttcttgacatctttgaaaagtctcattctaacaggttgttcaaaacttgatgagataagtgagaatctgaatcatgtggaatgcctggagaagcttaatataggcggaactgcaataagagatttatcattccttgtaggtatgaagaatttgaatggtctatactgccaaggatgtaaaggtctagctttaggatcatggaaaggtcattctgaaagtttgttgtttcctgctctattatccagtttgacttctttggtagagctagatttaagggattgcaatctggtggatggaaccattcccaatgatcttagcagcttaatctctttaagagaattaggtttaggtggtaatagttttgttcgattacctgaaagtatctctcaactctcaaagctcgagaaattagagttgagcaattgtaaacagcttcagttggtgcccaagcttccatcaagtgctcgactggtgcttgcagaagattgtacttcactgatagatttcccaaatcaaatcaaattattgccttcaattgagtctgggatgactactatcaattcactcagttctgcaagtagttcagcacttagagactcacatggtttcagtacgtggaaatcttcagcaaatgcccaaccttctgaagtgcttttgacacatgagcatacagagtggaaacgagttgatcaagtgtcactgccacttccaatgcttatgaaagacattgaactttctgatccatcatcaaaacccagtgatatcatttattttgataatgaaattccagagtggttcagcactatatctaccaccaatcctatatcaatctctatacctccagatctgacagatgatgacaagtggaagggggttacaatttgtgctgtttttgcagtcaagggacatactgttctctctgttattgaatcggatttagaactttcaaactacttctatcagtgcacaatggaaacagatgtttttcgtatgaaaccattcatctttgacggcgaagaaatccgccaccttcgatcaagttctcatctggttttgatttcctatgtagctagatggcagtttccaaagtgggagttaaatcaatcaaccacggtggcggctaaatttgaaaccaacaatccattcatggaggtccagaaatgtgggattcgtctagtttatgagcaagatgctggatggtataccaaactattccctggggttaatgcaatttgtctaaatgaagtgatggatgctatgctgaaaactggctggtttagtcaagtggatcaatatttgaaatgggagaaaattattccccccatcgaagaagactccagtacagttctgctaaggaagaacatcgagtctgttcttcctcgataccttgaggcattgaaccattatcctgcaacatacaaatttaacctcagaggaagcccgtcgtggtttgagtcctttttcactgatacaaggtcagggtcgactctagtgtcaattaagctgcctcaaaatctacacaagagtaagaagtggatggcatttgcaatatgtgcatcaattgcagaggaacagcaagaggactatcatgtttattttaaactcaaaacgggtgaatacaatgaggatctgtcccgagaacttgagtacattgtggcaatgtcgtcacaagcaaatcattatcaacttttggttgtgtacataccgcgggcattgattcccgaagtcttgctctctcggacatcaacaactgaaatgcacatttccttcagagtcgatactcctggtgcagaagttcaaagaagttgtggccgtattgtttaccaggaagatttagaagggtttgttgaaacaatcgtccggtgcatgcaaagagaagatactcttgaactttatgataaatgggtggtagaagattggatagacttgataggattgcaagggggtcatttatgtactccatacaaatgcaaatccatagcaggacgggaaaggaagtttgaattgctctctcagaaatataggaatcgggtctctctaacatacaccgccattttttttttcactagacacaagtcacatgaagaaccatatacttacattttgagtttttatttgcaggactgggctatgtctccaccttatatttgcgtcttctttggagctgaaatttccaagtggaattggttcatgcacttcaatgagggaaacaccgcaaaaatccaactgcctcctaatttgttctatgatgctaattggatggggattgctgtatgtggtttatgttgggcgtcccacgaagattcaaacattatactagacggtagtcctgacacagagtataatgtactcaatttgtgtctggactctgatgtcggttcggacggcttatttgatgtcaaattacagaaactttttgggaaactcaagccatgggaatttgaaaccgatatcacatttttcttctatatacctcgtgttaaatatttaaagttttggagacaattcaaccttgccagggttactttttcatcttctagcccatgcttaagagtctatagttgtgcccttcgtctagtctttaaggaggacgttgaagatctcgttcggacactgacactctccgaaataccgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

1811

Amino Acids

205.7

Weight (kDa)

5.89

Isoelectric Point (pI)

50.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000129)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g02050 FvH4_2g02050 FvH4_2g02050 FvH4_2g02050 FvH4_2g02050 FvH4_2g02050 FvH4_2g02050 FvH4_2g02050 FvH4_2g02050 FvH4_2g02050 FvH4_2g02050 FvH4_5g38500 FvH4_5g38520 FvH4_5g38540 FvH4_5g38540 FvH4_5g38540 FvH4_5g38561 FvH4_5g38561 FvH4_5g38561 FvH4_5g38561 FvH4_5g38600 FvH4_5g38620 FvH4_5g38630 FvH4_5g38660 FvH4_5g38680 FvH4_5g38680 FvH4_5g38680 FvH4_5g38680 FvH4_5g38680 FvH4_5g38760
malus_domestica MD05G1002100.v1.1 MD05G1002200.v1.1 MD05G1002300.v1.1 MD05G1002400.v1.1 MD07G1123900.v1.1 MD17G1192900.v1.1
prunus_persica Prupe.2G059400_v2.0.a1 Prupe.8G005400_v2.0.a1 Prupe.8G005500_v2.0.a1 Prupe.8G005500_v2.0.a1 Prupe.8G005600_v2.0.a1 Prupe.8G102900_v2.0.a1
pyrus_communis pycom05g00210 pycom05g00220 pycom05g00230 pycom07g11690
rosa_chinensis RchiOBHm_Chr6g0250791 RchiOBHm_Chr7g0223661 RchiOBHm_Chr7g0240571 RchiOBHm_Chr7g0240581 RchiOBHm_Chr7g0240591 RchiOBHm_Chr7g0240641 RchiOBHm_Chr7g0240681
rosa_laevigata RLG00000000629 RLG00000000630 RLG00000000632 RLG00000000636 RLG00000000637 RLG00000000638 RLG00000000639 RLG00000000640 RLG00000000648 RLG00000000657 RLG00000000661 RLG00000000664 RLG00000000666 RLG00000000669 RLG00000000672 RLG00000000673 RLG00000001954 RLG00000001970 RLG00000007791 RLG00000012997 RLG00000018666
rosa_multiflora Rmu_co8160218.1_g000001 Rmu_co8184794.1_g000001 Rmu_co8275571.1_g000001 Rmu_co8344485.1_g000001 Rmu_co8381261.1_g000001 Rmu_co8395583.1_g000001 Rmu_sc0001070.1_g000010 Rmu_sc0001070.1_g000016 Rmu_sc0001070.1_g000024 Rmu_sc0001070.1_g000025 Rmu_sc0001070.1_g000031 Rmu_sc0001209.1_g000012 Rmu_sc0001483.1_g000003 Rmu_sc0001483.1_g000013 Rmu_sc0001483.1_g000015 Rmu_sc0001921.1_g000013 Rmu_sc0001921.1_g000015 Rmu_sc0001921.1_g000019 Rmu_sc0001921.1_g000027 Rmu_sc0001921.1_g000028 Rmu_sc0001921.1_g000030 Rmu_sc0001924.1_g000001 Rmu_sc0001924.1_g000004 Rmu_sc0002517.1_g000003 Rmu_sc0002517.1_g000014 Rmu_sc0002551.1_g000001 Rmu_sc0002551.1_g000010 Rmu_sc0002551.1_g000031 Rmu_sc0002551.1_g000039 Rmu_sc0002551.1_g000040 Rmu_sc0004799.1_g000007 Rmu_sc0005071.1_g000006 Rmu_sc0005071.1_g000013 Rmu_sc0005071.1_g000019 Rmu_sc0005327.1_g000001 Rmu_sc0005327.1_g000002 Rmu_sc0009028.1_g000001 Rmu_sc0013246.1_g000001 Rmu_sc0014401.1_g000001 Rmu_sc0019569.1_g000001 Rmu_sc0019569.1_g000003 Rmu_sc0019569.1_g000004 Rmu_sc0020672.1_g000001 Rmu_sc0023716.1_g000001 Rmu_sc0037115.1_g000001 Rmu_sc0038364.1_g000001 Rmu_ssc0000011.1_g000037
rosa_roxburghii Rroxscaffold_2G00121840 Rroxscaffold_2G00121850 Rroxscaffold_2G00121870 Rroxscaffold_3G00219670 Rroxscaffold_3G00219690 Rroxscaffold_3G00219710 Rroxscaffold_3G00219770 Rroxscaffold_3G00219810 Rroxscaffold_3G00219820 Rroxscaffold_3G00219850 Rroxscaffold_3G00219870 Rroxscaffold_3G00231380 Rroxscaffold_3G00235440 Rroxscaffold_3G00236130 Rroxscaffold_3G00236140 Rroxscaffold_3G00236270 Rroxscaffold_3G00236280 Rroxscaffold_3G00240810
rosa_rugosa Rorug02G0237100 Rorug07G0218500 Rorug07G0218600 Rorug07G0218600 Rorug07G0218700 Rorug07G0323600 Rorug07G0337100 Rorug07G0337200 Rorug07G0337500 Rorug07G0337700 Rorug07G0337800 Rorug07G0337800 Rorug07G0338000 Rorug07G0338100 Rorug07G0338200 Rorug07G0338300
rosa_samantha Rh1BG151400 Rh2CG282500 Rh2DG318800 Rh2DG318900 Rh2DG319100 Rh5BG508500 Rh6BG254000 Rh6DG245200 Rh7AG361400 Rh7AG491500 Rh7AG492000 Rh7AG492300 Rh7AG492400 Rh7AG492500 Rh7AG492800 Rh7BG464100 Rh7BG464500 Rh7BG464700 Rh7BG464800 Rh7CG379900 Rh7CG507500 Rh7CG508000 Rh7CG508700 Rh7CG508900 Rh7CG509900 Rh7CG510400 Rh7CG510500 Rh7CG510600 Rh7CG510700 Rh7CG511000 Rh7CG511200
rosa_wichuraiana Rw0G005770 Rw7G041180 Rw7G041190 Rw7G041250 Rw7G041270 Rw7G041280 Rw7G041300 Rw7G041330 Rw7G041410 Rw7G041420 Rw7G041440 Rw7G041460 Rw7G041470 Rw7G041480 Rw7G041500 Rw7G041530 Rw7G041540 Rw7G041570 Rw7G041580 Rw7G041600 Rw7G041630 Rw7G041660 Rw7G041680

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 2 cut(s) 4291, 5171
Acc36I ACCTGC 1 cut(s) 224
AccB1I GGYRCC 1 cut(s) 3241
AccBSI CCGCTC 2 cut(s) 63, 460
AccI GTMKAC 4 cut(s) 1719, 2429, 4001, 4283
AccII CGCG 5 cut(s) 51, 93, 229, 448, 4507
AccIII TCCGGA 2 cut(s) 1144, 1909
AclWI GGATC 8 cut(s) 269, 848, 891, 1490, 3001, 3533, 4095, 4434
AcoI YGGCCR 1 cut(s) 4609
AcuI CTGAAG 9 cut(s) 1559, 1587, 1652, 2049, 2315, 3218, 3408, 3465, 4552
AcyI GRCGYC 1 cut(s) 5090
AfiI CCNNNNNNNGG 5 cut(s) 196, 548, 1909, 2513, 5317
AflII CTTAAG 1 cut(s) 5347
AhdI GACNNNNNGTC 1 cut(s) 827
AhlI ACTAGT 1 cut(s) 2696
AjuI GAANNNNNNNTTGG 4 cut(s) 1814, 1846, 3926, 3958
AloI GAACNNNNNNTCC 2 cut(s) 3696, 3728
Alw21I GWGCWC 3 cut(s) 122, 3265, 3767
Alw44I GTGCAC 1 cut(s) 3763
AlwI GGATC 8 cut(s) 269, 848, 891, 1490, 3001, 3533, 4095, 4434
AlwNI CAGNNNCTG 1 cut(s) 2263
Ama87I CYCGRG 3 cut(s) 674, 3200, 4434
Aor13HI TCCGGA 2 cut(s) 1144, 1909
AoxI GGCC 5 cut(s) 12, 379, 409, 1666, 4609
ApaLI GTGCAC 1 cut(s) 3763
ApeKI GCWGC 6 cut(s) 57, 454, 1245, 2346, 3117, 4303
ArsI GACNNNNNNTTYG 2 cut(s) 5174, 5206
AseI ATTAAT 1 cut(s) 1776
Asp700I GAANNNNTTC 4 cut(s) 1572, 1626, 3797, 4985
AspLEI GCGC 2 cut(s) 95, 292
AspS9I GGNCC 7 cut(s) 380, 443, 613, 695, 1423, 1469, 3952
AsuHPI GGTGA 5 cut(s) 1042, 1097, 1558, 2495, 4424
AsuII TTCGAA 1 cut(s) 1316
AsuNHI GCTAGC 1 cut(s) 83
AvaI CYCGRG 3 cut(s) 674, 3200, 4434
AvaII GGWCC 6 cut(s) 443, 613, 695, 1423, 1469, 3952
BaeGI GKGCMC 3 cut(s) 3246, 3767, 5368
BaeI ACNNNNGTAYC 2 cut(s) 1979, 2012
BanI GGYRCC 1 cut(s) 3241
BanII GRGCYC 1 cut(s) 122
BauI CACGAG 1 cut(s) 5274
BbsI GAAGAC 3 cut(s) 877, 4137, 4945
Bbv12I GWGCWC 3 cut(s) 122, 3265, 3767
BbvI GCAGC 6 cut(s) 69, 466, 1257, 2333, 3129, 4290
BceAI ACGGC 5 cut(s) 208, 2408, 3826, 4596, 5200
BclI TGATCA 2 cut(s) 2086, 3487
BcuI ACTAGT 1 cut(s) 2696
BfmI CTRYAG 2 cut(s) 2106, 5356
BfoI RGCGCY 1 cut(s) 293
BfrI CTTAAG 1 cut(s) 5347
BfuAI ACCTGC 1 cut(s) 224
BglII AGATCT 2 cut(s) 3643, 5398
Bme18I GGWCC 6 cut(s) 443, 613, 695, 1423, 1469, 3952
BmeRI GACNNNNNGTC 1 cut(s) 827
BmeT110I CYCGRG 3 cut(s) 674, 3200, 4434
BmgT120I GGNCC 7 cut(s) 380, 443, 613, 695, 1423, 1469, 3952
BmiI GGNNCC 4 cut(s) 382, 2451, 3097, 3243
BmrI ACTGGG 4 cut(s) 830, 2781, 3549, 4933
BmtI GCTAGC 1 cut(s) 87
BmuI ACTGGG 4 cut(s) 830, 2781, 3549, 4933
BoxI GACNNNNGTC 3 cut(s) 2277, 4873, 5124
BpiI GAAGAC 3 cut(s) 877, 4137, 4945
BpmI CTGGAG 5 cut(s) 2418, 2696, 2906, 3624, 4120
Bpu10I CCTNAGC 1 cut(s) 4151
Bpu14I TTCGAA 1 cut(s) 1316
BpuEI CTTGAG 7 cut(s) 1274, 2480, 2507, 2618, 4208, 4463, 5210
Bsa29I ATCGAT 1 cut(s) 689
BsaAI YACGTR 2 cut(s) 561, 3414
BsaBI GATNNNNATC 1 cut(s) 3081
BsaHI GRCGYC 1 cut(s) 5090
BsaI GGTCTC 1 cut(s) 4837
BsaWI WCCGGW 6 cut(s) 114, 548, 1144, 1909, 2311, 4659
BsaXI ACNNNNNCTCC 8 cut(s) 104, 123, 134, 153, 1521, 1551, 1914, 1944
Bsc4I CCNNNNNNNGG 5 cut(s) 196, 548, 1909, 2513, 5317
Bse1I ACTGG 9 cut(s) 836, 2740, 2787, 3042, 3273, 3555, 4072, 4137, 4928
Bse3DI GCAATG 2 cut(s) 1836, 4464
Bse8I GATNNNNATC 1 cut(s) 3081
BseAI TCCGGA 2 cut(s) 1144, 1909
BseCI ATCGAT 1 cut(s) 689
BseJI GATNNNNATC 1 cut(s) 3081
BseLI CCNNNNNNNGG 5 cut(s) 196, 548, 1909, 2513, 5317
BseMI GCAATG 2 cut(s) 1836, 4464
BseMII CTCAG 9 cut(s) 852, 1244, 1316, 1528, 2172, 2436, 3379, 4243, 4826
BseNI ACTGG 9 cut(s) 836, 2740, 2787, 3042, 3273, 3555, 4072, 4137, 4928
BseRI GAGGAG 2 cut(s) 139, 2114
BseSI GKGCMC 3 cut(s) 3246, 3767, 5368
BseXI GCAGC 6 cut(s) 69, 466, 1257, 2333, 3129, 4290
BsgI GTGCAG 3 cut(s) 1308, 1539, 4608
Bsh1236I CGCG 5 cut(s) 51, 93, 229, 448, 4507
BshFI GGCC 5 cut(s) 14, 381, 411, 1668, 4611
BshNI GGYRCC 1 cut(s) 3241
BshVI ATCGAT 1 cut(s) 689
BsiHKAI GWGCWC 3 cut(s) 122, 3265, 3767
BsiHKCI CYCGRG 3 cut(s) 674, 3200, 4434
BsiSI CCGG 6 cut(s) 115, 549, 1145, 1910, 2312, 4660
BsiWI CGTACG 1 cut(s) 561
BslFI GGGAC 8 cut(s) 216, 834, 2285, 2581, 2707, 3717, 4417, 5077
BslI CCNNNNNNNGG 5 cut(s) 196, 548, 1909, 2513, 5317
BsmBI CGTCTC 3 cut(s) 432, 654, 2786
BsmFI GGGAC 8 cut(s) 216, 834, 2285, 2581, 2707, 3717, 4417, 5077
BsmI GAATGC 5 cut(s) 85, 2338, 2391, 2571, 2885
BsnI GGCC 5 cut(s) 14, 381, 411, 1668, 4611
Bso31I GGTCTC 1 cut(s) 4837
BsoBI CYCGRG 3 cut(s) 674, 3200, 4434
Bsp119I TTCGAA 1 cut(s) 1316
Bsp1286I GDGCHC 5 cut(s) 122, 3246, 3265, 3767, 5368
Bsp13I TCCGGA 2 cut(s) 1144, 1909
Bsp1407I TGTACA 4 cut(s) 1342, 1921, 2483, 4497
Bsp19I CCATGG 2 cut(s) 816, 5231
BspANI GGCC 5 cut(s) 14, 381, 411, 1668, 4611
BspCNI CTCAG 9 cut(s) 853, 1243, 1317, 1527, 2171, 2437, 3378, 4242, 4825
BspDI ATCGAT 1 cut(s) 689
BspEI TCCGGA 2 cut(s) 1144, 1909
BspFNI CGCG 5 cut(s) 51, 93, 229, 448, 4507
BspLI GGNNCC 4 cut(s) 382, 2451, 3097, 3243
BspMAI CTGCAG 1 cut(s) 2110
BspMI ACCTGC 1 cut(s) 224
BspOI GCTAGC 1 cut(s) 87
BspPI GGATC 8 cut(s) 269, 848, 891, 1490, 3001, 3533, 4095, 4434
BspQI GCTCTTC 2 cut(s) 1578, 2025
BspT104I TTCGAA 1 cut(s) 1316
BspT107I GGYRCC 1 cut(s) 3241
BspTI CTTAAG 1 cut(s) 5347
BspTNI GGTCTC 1 cut(s) 4837
BsrBI CCGCTC 2 cut(s) 63, 460
BsrDI GCAATG 2 cut(s) 1836, 4464
BsrGI TGTACA 4 cut(s) 1342, 1921, 2483, 4497
BsrI ACTGG 9 cut(s) 836, 2740, 2787, 3042, 3273, 3555, 4072, 4137, 4928
BssNAI GTATAC 1 cut(s) 4002
BssNI GRCGYC 1 cut(s) 5090
BssSI CACGAG 1 cut(s) 5274
BssT1I CCWWGG 4 cut(s) 406, 816, 2968, 5231
Bst1107I GTATAC 1 cut(s) 4002
Bst2BI CACGAG 1 cut(s) 5274
Bst6I CTCTTC 2 cut(s) 1578, 2025
BstACI GRCGYC 1 cut(s) 5090
BstAFI CTTAAG 1 cut(s) 5347
BstAPI GCANNNNNTGC 3 cut(s) 2105, 4352, 4361
BstAUI TGTACA 4 cut(s) 1342, 1921, 2483, 4497
BstBAI YACGTR 2 cut(s) 561, 3414
BstBI TTCGAA 1 cut(s) 1316
BstC8I GCNNGC 7 cut(s) 85, 221, 399, 2672, 3276, 4509, 4667
BstDSI CCRYGG 4 cut(s) 816, 3909, 4505, 5231
BstFNI CGCG 5 cut(s) 51, 93, 229, 448, 4507
BstH2I RGCGCY 1 cut(s) 293
BstHHI GCGC 2 cut(s) 95, 292
BstNSI RCATGY 3 cut(s) 401, 1845, 4669
BstPAI GACNNNNGTC 3 cut(s) 2277, 4873, 5124
BstSFI CTRYAG 2 cut(s) 2106, 5356
BstSLI GKGCMC 3 cut(s) 3246, 3767, 5368
BstUI CGCG 5 cut(s) 51, 93, 229, 448, 4507
BstV1I GCAGC 6 cut(s) 69, 466, 1257, 2333, 3129, 4290
BstV2I GAAGAC 3 cut(s) 877, 4137, 4945
BstX2I RGATCY 3 cut(s) 3643, 4426, 5398
BstXI CCANNNNNNTGG 4 cut(s) 25, 422, 1616, 3962
BstYI RGATCY 3 cut(s) 3643, 4426, 5398
BstZ17I GTATAC 1 cut(s) 4002
Bsu15I ATCGAT 1 cut(s) 689
BsuRI GGCC 5 cut(s) 14, 381, 411, 1668, 4611
BsuTUI ATCGAT 1 cut(s) 689
BtgI CCRYGG 4 cut(s) 816, 3909, 4505, 5231
BtgZI GCGATG 1 cut(s) 378
BtsI GCAGTG 3 cut(s) 1296, 2103, 3497
BveI ACCTGC 1 cut(s) 224
Cac8I GCNNGC 7 cut(s) 85, 221, 399, 2672, 3276, 4509, 4667
CaiI CAGNNNCTG 1 cut(s) 2263
CfoI GCGC 2 cut(s) 95, 292
Cfr13I GGNCC 7 cut(s) 380, 443, 613, 695, 1423, 1469, 3952
Cfr42I CCGCGG 1 cut(s) 4508
ClaI ATCGAT 1 cut(s) 689
CpoI CGGWCCG 1 cut(s) 443
CseI GACGC 5 cut(s) 218, 968, 2768, 4939, 5079
CspCI CAANNNNNGTGG 4 cut(s) 358, 393, 3894, 3929
CspI CGGWCCG 1 cut(s) 443
DraI TTTAAA 4 cut(s) 1852, 2541, 4399, 5289
DrdI GACNNNNNNGTC 2 cut(s) 4291, 5171
DriI GACNNNNNGTC 1 cut(s) 827
DseDI GACNNNNNNGTC 2 cut(s) 4291, 5171
EaeI YGGCCR 1 cut(s) 4609
Eam1104I CTCTTC 2 cut(s) 1578, 2025
Eam1105I GACNNNNNGTC 1 cut(s) 827
EarI CTCTTC 2 cut(s) 1578, 2025
EciI GGCGGA 2 cut(s) 2919, 3812
Ecl136II GAGCTC 1 cut(s) 120
Eco130I CCWWGG 4 cut(s) 406, 816, 2968, 5231
Eco147I AGGCCT 2 cut(s) 14, 411
Eco24I GRGCYC 1 cut(s) 122
Eco31I GGTCTC 1 cut(s) 4837
Eco32I GATATC 2 cut(s) 3562, 5251
Eco47I GGWCC 6 cut(s) 443, 613, 695, 1423, 1469, 3952
Eco53kI GAGCTC 1 cut(s) 120
Eco57I CTGAAG 9 cut(s) 1559, 1587, 1652, 2049, 2315, 3218, 3408, 3465, 4552
Eco88I CYCGRG 3 cut(s) 674, 3200, 4434
EcoICRI GAGCTC 1 cut(s) 120
EcoRV GATATC 2 cut(s) 3562, 5251
EcoT14I CCWWGG 4 cut(s) 406, 816, 2968, 5231
EcoT22I ATGCAT 2 cut(s) 1980, 2340
EcoT38I GRGCYC 1 cut(s) 122
ErhI CCWWGG 4 cut(s) 406, 816, 2968, 5231
Esp3I CGTCTC 3 cut(s) 432, 654, 2786
FalI AAGNNNNNCTT 4 cut(s) 1293, 1325, 4668, 4700
FaqI GGGAC 8 cut(s) 216, 834, 2285, 2581, 2707, 3717, 4417, 5077
FauI CCCGC 4 cut(s) 98, 198, 605, 4500
FbaI TGATCA 2 cut(s) 2086, 3487
FblI GTMKAC 4 cut(s) 1719, 2429, 4001, 4283
FriOI GRGCYC 1 cut(s) 122
GlaI GCGC 2 cut(s) 94, 291
GsuI CTGGAG 5 cut(s) 2418, 2696, 2906, 3624, 4120
HaeII RGCGCY 1 cut(s) 293
HaeIII GGCC 5 cut(s) 14, 381, 411, 1668, 4611
HapII CCGG 6 cut(s) 115, 549, 1145, 1910, 2312, 4660
HgaI GACGC 5 cut(s) 218, 968, 2768, 4939, 5079
HhaI GCGC 2 cut(s) 95, 292
Hin1I GRCGYC 1 cut(s) 5090
Hin6I GCGC 2 cut(s) 93, 290
HinP1I GCGC 2 cut(s) 93, 290
HincII GTYRAC 2 cut(s) 2430, 4284
HindII GTYRAC 2 cut(s) 2430, 4284
HindIII AAGCTT 3 cut(s) 2668, 2891, 3248
HpaII CCGG 6 cut(s) 115, 549, 1145, 1910, 2312, 4660
HphI GGTGA 5 cut(s) 1042, 1097, 1558, 2495, 4424
Hpy99I CGWCG 5 cut(s) 229, 529, 532, 2136, 4246
HpyCH4IV ACGT 5 cut(s) 560, 2044, 2131, 3413, 5391
HpySE526I ACGT 5 cut(s) 560, 2044, 2131, 3413, 5391
Hsp92I GRCGYC 1 cut(s) 5090
HspAI GCGC 2 cut(s) 93, 290
Kpn2I TCCGGA 2 cut(s) 1144, 1909
Ksp22I TGATCA 2 cut(s) 2086, 3487
KspI CCGCGG 1 cut(s) 4508
LguI GCTCTTC 2 cut(s) 1578, 2025
LmnI GCTCC 5 cut(s) 106, 117, 125, 2677, 4961
Lsp1109I GCAGC 6 cut(s) 69, 466, 1257, 2333, 3129, 4290
MaeII ACGT 5 cut(s) 560, 2044, 2131, 3413, 5391
MaeIII GTNAC 7 cut(s) 2253, 2765, 3495, 3673, 4464, 4875, 5320
MbiI CCGCTC 2 cut(s) 63, 460
MfeI CAATTG 4 cut(s) 1436, 3220, 3333, 4359
MflI RGATCY 3 cut(s) 3643, 4426, 5398
MhlI GDGCHC 5 cut(s) 122, 3246, 3265, 3767, 5368
MmeI TCCRAC 3 cut(s) 1597, 2152, 5047
Mph1103I ATGCAT 2 cut(s) 1980, 2340
MroI TCCGGA 2 cut(s) 1144, 1909
MroXI GAANNNNTTC 4 cut(s) 1572, 1626, 3797, 4985
MslI CAYNNNNRTG 8 cut(s) 23, 420, 1110, 1355, 2180, 2688, 4765, 4998
MspA1I CMGCKG 3 cut(s) 193, 1612, 4507
MspCI CTTAAG 1 cut(s) 5347
MspI CCGG 6 cut(s) 115, 549, 1145, 1910, 2312, 4660
MunI CAATTG 4 cut(s) 1436, 3220, 3333, 4359
Mva1269I GAATGC 5 cut(s) 85, 2338, 2391, 2571, 2885
MvnI CGCG 5 cut(s) 51, 93, 229, 448, 4507
NcoI CCATGG 2 cut(s) 816, 5231
NheI GCTAGC 1 cut(s) 83
NlaIV GGNNCC 4 cut(s) 382, 2451, 3097, 3243
NmuCI GTSAC 3 cut(s) 3495, 4464, 4875
NsiI ATGCAT 2 cut(s) 1980, 2340
NspI RCATGY 3 cut(s) 401, 1845, 4669
NspV TTCGAA 1 cut(s) 1316
PaeI GCATGC 2 cut(s) 401, 4669
PaeR7I CTCGAG 2 cut(s) 674, 3200
PasI CCCWGGG 1 cut(s) 4016
PceI AGGCCT 2 cut(s) 14, 411
PciSI GCTCTTC 2 cut(s) 1578, 2025
PctI GAATGC 5 cut(s) 85, 2338, 2391, 2571, 2885
PdmI GAANNNNTTC 4 cut(s) 1572, 1626, 3797, 4985
Pfl23II CGTACG 1 cut(s) 561
PfoI TCCNGGA 1 cut(s) 1932
Ppu21I YACGTR 2 cut(s) 561, 3414
PshAI GACNNNNGTC 3 cut(s) 2277, 4873, 5124
PshBI ATTAAT 1 cut(s) 1776
Psp124BI GAGCTC 1 cut(s) 122
PspLI CGTACG 1 cut(s) 561
PspN4I GGNNCC 4 cut(s) 382, 2451, 3097, 3243
PspPI GGNCC 7 cut(s) 380, 443, 613, 695, 1423, 1469, 3952
PsrI GAACNNNNNNTAC 2 cut(s) 554, 586
PstI CTGCAG 1 cut(s) 2110
PstNI CAGNNNCTG 1 cut(s) 2263
PsuI RGATCY 3 cut(s) 3643, 4426, 5398
PvuII CAGCTG 1 cut(s) 1612
RseI CAYNNNNRTG 8 cut(s) 23, 420, 1110, 1355, 2180, 2688, 4765, 4998
Rsr2I CGGWCCG 1 cut(s) 443
RsrII CGGWCCG 1 cut(s) 443
SacI GAGCTC 1 cut(s) 122
SacII CCGCGG 1 cut(s) 4508
SalI GTCGAC 2 cut(s) 2428, 4282
SapI GCTCTTC 2 cut(s) 1578, 2025
Sau96I GGNCC 7 cut(s) 380, 443, 613, 695, 1423, 1469, 3952
SduI GDGCHC 5 cut(s) 122, 3246, 3265, 3767, 5368
SfcI CTRYAG 2 cut(s) 2106, 5356
Sfr274I CTCGAG 2 cut(s) 674, 3200
Sfr303I CCGCGG 1 cut(s) 4508
SfuI TTCGAA 1 cut(s) 1316
SgrBI CCGCGG 1 cut(s) 4508
SinI GGWCC 6 cut(s) 443, 613, 695, 1423, 1469, 3952
SlaI CTCGAG 2 cut(s) 674, 3200
SmiMI CAYNNNNRTG 8 cut(s) 23, 420, 1110, 1355, 2180, 2688, 4765, 4998
SpeI ACTAGT 1 cut(s) 2696
SphI GCATGC 2 cut(s) 401, 4669
SseBI AGGCCT 2 cut(s) 14, 411
SspI AATATT 3 cut(s) 1884, 4094, 5285
SstI GAGCTC 1 cut(s) 122
StuI AGGCCT 2 cut(s) 14, 411
StyI CCWWGG 4 cut(s) 406, 816, 2968, 5231
TaiI ACGT 5 cut(s) 563, 2047, 2134, 3416, 5394
TauI GCSGC 4 cut(s) 63, 290, 460, 3920
TseFI GTSAC 3 cut(s) 3495, 4464, 4875
TseI GCWGC 6 cut(s) 57, 454, 1245, 2346, 3117, 4303
Tsp45I GTSAC 3 cut(s) 3495, 4464, 4875
TspGWI ACGGA 4 cut(s) 142, 456, 626, 2003
Vha464I CTTAAG 1 cut(s) 5347
VneI GTGCAC 1 cut(s) 3763
VpaK11BI GGWCC 6 cut(s) 443, 613, 695, 1423, 1469, 3952
VspI ATTAAT 1 cut(s) 1776
XbaI TCTAGA 1 cut(s) 1496
XceI RCATGY 3 cut(s) 401, 1845, 4669
XcmI CCANNNNNNNNNTGG 1 cut(s) 310
XhoI CTCGAG 2 cut(s) 674, 3200
XmiI GTMKAC 4 cut(s) 1719, 2429, 4001, 4283
XmnI GAANNNNTTC 4 cut(s) 1572, 1626, 3797, 4985
Zsp2I ATGCAT 2 cut(s) 1980, 2340
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.